quarta-feira, 31 de dezembro de 2025

Kill Lists, Covert Ops: Candace Owens’ Alarming Allegation



Freddie Ponton
21st Century Wire

The idea of a government quietly assembling lists of people to be eliminated might sound like something from a John le Carré spy thriller, but in France, it’s actually documented history. In 2017, the French media outlet Le Monde published an excerpt from an investigation conducted by a reputable investigative journalist, Vincent Nouzille, which shocked even seasoned observers of intelligence affairs. The French newspaper revealed some of the findings described in Nouzille’s book, titled “Erreurs fatales“, where he explores the grey areas of the French intelligence services, and asserts that for years, France has compiled lists of individuals marked for assassination—people considered hostile not only because of acts of terrorism or kidnaping, but for operating “against France’s interests.”

According to the report, these names were submitted directly to the President of the Republic for approval. Former French President François Hollande, in interviews cited in the article, acknowledged that he himself had authorised such killings, giving his personal assent to operations conducted by the French Secret Services (DGSE) or military special forces—far from any courtroom or judicial oversight. Interestingly, French records indicate that Emmanuel Macron was an advisor to then President Hollande at Élysée Palace for two years before becoming Francois Hollande’s Minister of the Economy, Industry and Digital Affairs in 2014. Whether he was aware of such a policy is still unclear. Nonetheless, the very existence of the policy should be beyond rebuttal at this point. 

The revelations from the investigation describes a clandestine apparatus capable of operating across continents, while executing missions with minimal transparency, and with absolute political discretion. Judges in France were often outraged to discover that individuals they sought to investigate had been subsequently killed without any consultation. Intelligence officials, meanwhile, defended the practice as a necessary extension of state power in a dangerous world. Whatever one’s interpretation, the reporting left little doubt: the French state has not only built the capacity for such extrajudicial action, it has actually used it.

In France, many people still vividly recall the tale of a “Freemason killer network”, which included members of the “Athanor Lodge. Their sinister actions sparked a captivating, yet deeply unsettling investigation which would uncovered a criminal organization linked directly to DGSE enforcers. Some of the individuals implicated and arrested in 2020 were operatives of the French intelligence agencies, both foreign (DGSE) and domestic (DGSI), who faced prosecution in 2023 for their roles in the attempted murder of a business leader. Other allegations pointed towards evidence of a conspiracy to kill a trade unionist, as well as several other brutal attacks, as reported by the French media outlet RTL. None of the targeted individuals were known terrorists or declared enemies of the state. Rather, they were citizens that somehow ended up on a “kill list”, treated by the state apparatus as High Value Targets (HVAs). Read more from this investigation at the French outlet Le Figaro here.

It is against this historical backdrop, one defined by secrecy, presidentially approved kill lists, and a long record of so-called “neutralisations”, that high-profile American podcaster Candace Owens’ recent allegations have landed. When she took to her X account to warn that she had been informed of an assassination plot ordered by the President of France, the claim did not land in a vacuum. It collided with the very real historical evidence that France possesses both the mechanisms and the precedent for covert lethal operations.

Owens did not deliver her warning tentatively. She has divulged how a highly placed operative within the French government had contacted her, someone she says has been verified and deemed credible. The message she claims to have received was stark: she is being targeted, the order had been approved, and an elite unit had been authorised to execute that order. From there, her posts unfolded with the urgency of someone convinced that her own life is currently in danger, asserting that she has evidence, documents, and names supporting what she has called a criminal conspiracy.

She claims that this whistleblower told her the Macrons had “executed upon and paid for” her assassination and that the operation had been assigned to a specialised GIGN team.

“Among its many capabilities, the GIGN is also an integral part of the Air Marshal community. As the only authorized French entity, the GIGN was one of the nine founding members of the International Flight Security Officer Committee (IIFSOC) network, along with the United States, Canada, Australia, and five other European countries. Today, this community continues to grow and now comprises nearly twenty members. In addition to helping standardize practices internationally, this network allows for building contacts with a significant number of partners in case of operational needs.”
(Source: GIGN National Gendarmerie Intervention Group)

In her last post, she intimates that “Macron allegedly moved $1.5 million for her assassination”, which, according to an earlier post, transited through international accounts in France and Canada, allegedly via the infamous network of the exclusive “Club des Cent” in France, whose elite members include the likes of Eric de Rothschild.

I’ve recently shared on X some background information regarding the Club des Cent in France, which she has also reposted on her timeline.

 Owens added that a French female assassin and an Israeli operative are alleged to be part of the assassination group. She has also connected this alleged plot to the recent killing of American conservative activist Charlie Kirk, saying that her source claimed Kirk’s killer trained with the French Foreign Legion’s 13th Brigade in what she describes as “multi-state involvement.” She warned too that Xavier Poussard, a French investigative journalist and author of the book “Becoming Brigitte“, might also be a target.

Throughout her posts, she claims to have concrete evidence; documents, communications, names, and financial trails, and reiterates that she has already notified figures within the U.S. government of her situation. She also has suggested she had been advised to remain silent, but that she has refused to do so. Her message to the public seems to indicate that she sees visibility as protection.

These claims, carried by the momentum of her own certainty, merge uncomfortably with France’s known history of such clandestine operations. What France once carried out quietly in the Sahel, Libya, Afghanistan, Somalia, and other “grey zones”, as well as in Europe itself—has now been pulled into a vastly different narrative, one involving a leading American commentator who says she holds the receipts. 

SEE ALSO: Past as Prologue: Safari Club Sheds Illuminates Candace Owens’ Allegations

Telegram CEO, Pavel Durov, who went through his own turbulent episode in France involving an unexpected airport arrest, to his uneasy dealings with French intelligence, and the political circles around President Macron, recently posted a message on X, where he considers Candace Owens’ claims about French involvement in Charlie Kirk’s death to be “plausible”— a reaction shaped as much by personal experience as by principle of historic precedent. By engaging in her narrative, Durov lends some additional weight to the story. 

 Whether Candace’s evidence will be released, and what it might show us—remains a question only she can answer for now. However, her warnings join a long and complicated traceable lineage of covert state actions initiated by the French state—a reality which is already well-documented in the pages of France’s own newspapers of record.

Over the weekend, most mainstream French media reacted in concert, predictably calling Candace Owens a “conspiracy theorist” and a “cyberbully”, characterising her allegations as “lunar”. But, is it wise to disregard her claim just because her allegations are deemed to be too “fringe” by mainstream media standards? Perhaps it would be more prudent for us to take a moment and pause, and take into consideration that precedents which exist, and afford her the time and the appropriate setting to disclose her evidence.


.
Le Monde reports…

François Hollande and “the license to kill”

In a book titled “Fatal Errors,” published today, independent journalist Vincent Nouzille recounts how France compiles lists of terrorists to be eliminated, which are then submitted to the President of the Republic for approval, even at the expense of justice. Excerpts.

Independent journalist Vincent Nouzille has spent years exploring the gray areas of the intelligence services. In Fatal Errors (Fayard/Les Liens qui libèrent, €20, 384 pages), he delves into the heart of the French counterterrorism effort and recounts, after a lengthy investigation, how, since the early 1980s, the authorities have failed to prevent the most serious attacks. Le Monde is publishing excerpts.

Extrajudicial killings ordered by the president

“Since his election in May 2012, François Hollande has sought to embody a more militaristic policy than his predecessors, even at the cost of overstepping the bounds of legality. Thus, he has decided to systematically retaliate against hostage-takings and attacks affecting French citizens worldwide. In an interview with journalists Gérard Davet and Fabrice Lhomme, he admitted to having ordered such acts of revenge: ‘The army and the DGSE (General Directorate for External Security) have a list of people suspected of being responsible for hostage-takings or acts against our interests. I was questioned. I said: “If you apprehend them, of course…”’ These remarks confirm what we wrote at the beginning of 2015, namely that France is compiling lists of names of people to be eliminated, which are subject to the president’s approval.”

Surrounded by action-oriented military advisors, including his chief of staff, General Benoît Puga, and members of Jean-Yves Le Drian’s cabinet, François Hollande gave clear instructions to the military high command and the DGSE (General Directorate for External Security) on this matter: they have his green light to kill “terrorist leaders” and other suspected enemies of France abroad, including clandestinely. The military refers to them as High Value Targets (HVTs) or High Value Individuals (HVIs) – in short, high-value targets. (…)

The president confided to Gérard Davet and Fabrice Lhomme that he had ordered at least four targeted assassinations during his term. A minimal figure, in truth. According to our sources, at least forty targeted killings were carried out abroad between 2013 and 2016, either by the armed forces, the DGSE (France’s external intelligence agency), or, more indirectly, by allied countries based on intelligence provided by France. This represents roughly one operation per month—a rate unseen since the late 1950s, during the Algerian War. From this perspective, François Hollande marks a real break with the use of force, whereas Nicolas Sarkozy and especially Jacques Chirac were more cautious on these matters of national sovereignty.

Officially, military headquarters reject the term “targeted killings.” The military prefers to speak more generally of “neutralizing” “enemy targets” and ” strategic objectives .” They deny any prior identification of the individuals targeted. These denials reflect a certain unease, linked to ethical reservations and the legal ambiguity surrounding this type of counterterrorism operation. Indeed, in the event of a declared military conflict, endorsed by Parliament and international bodies such as the UN, special operations can be considered acts of war and the targets enemy combatants, which does not, in principle, pose too many legal problems.

Conversely, when special forces or agents of the DGSE’s Action Service (SA) intervene in “grey zones” or on the fringes of a conventional military operation, the legal framework is more uncertain: they could face prosecution in the countries concerned. The risk remains theoretical, but it must be taken into account, as missions of this type have proliferated in recent years. Between 2008 and 2013, French special forces and the DGSE, for example, captured or killed nearly a hundred jihadists in certain Sahel countries (Mauritania, Mali, Niger) without any legally launched military operation. Not to mention the raids carried out in Libya in 2011 with the utmost discretion, or the DGSE’s operation in Somalia in January 2013, deep within a “grey zone.”

In reality, France applies the law of retaliation and goes even further. This “license to kill” sometimes resembles cold-blooded reprisals and extrajudicial killings, including preemptive ones. Military strikes have little to do with judicial procedures. The legitimacy of these actions can be accepted when it comes to responding to aggression. But their legality is often questioned, as is their actual effectiveness in the fight against terrorism, since they do not prevent rebel groups from regrouping and they increase the risk of escalation. “France is at war, it kills enemy leaders, nothing could be more normal ,” argues a veteran of the DGSE (France’s external intelligence agency), a supporter of these “Homo” (for homicide) operations.

According to intelligence officials, the hunt for human targets is meticulously planned. In September 2015, speaking about these operations in an exceptional manner, General Christophe Gomart, head of the Directorate of Military Intelligence (DRM), detailed the process to an audience of experts at the Defense Summer School: “Targets of interest, the leaders of armed terrorist groups, are very difficult to intercept due to their mobility and the discretion they employ. The process aims to progressively narrow down the net in order to identify and then locate the target before launching the operation. This work is conducted in partnership with other services within the national intelligence community, according to the principle we call ‘Find, Fix , Finish, Exploit’ .”

Targeting is refined using electronic intelligence, prisoner interrogations and imagery studies, which then allow for the formal identification of the target and its tracking “until the most favorable time to trigger the operation” (…).

Bernard Bajolet, the head of the DGSE (France’s external intelligence agency), provided further details on the subject. Questioned behind closed doors in May 2016 by the parliamentary inquiry commission investigating the 2015 attacks, he indicated that his agency had conducted sixty-nine operations to “thwart the terrorist threat” since the beginning of 2013. Fifty-one of these involved arrests, foiled plots, or the neutralization of terrorists in the following areas, listed in order of importance: sub-Saharan Africa, the Afghan-Pakistani region, the Horn of Africa, Syria, Europe, Libya, and Egypt. The DGSE reportedly contributed directly to forty such operations during this period, some of which were executions—the exact number of which was not specified.

Angry judges

Naturally, on instructions from the Élysée Palace, the military commands generally conduct these special operations with the utmost discretion. They are classified as “Defense Confidential” and only exceptionally result in military communiqués. The President of the Republic, the Minister of Defense, and the Chief of the Defence Staff, however, regularly wish to demonstrate that France now retaliates against any attack against its interests and relentlessly pursues those responsible in order to eliminate them. This comes at the risk of clashing with magistrates tasked with investigating terrorist acts and eager to one day bring the perpetrators to justice, as is the case, notably, in the Arlit hostage crisis, the death of Philippe Verdon, and the murders of the two RFI journalists.

Because the judges, as well as the civil parties, are deeply unhappy with the extrajudicial executions decided at the highest levels, which, according to some of them, amount to the reinstatement of the death penalty without any form of trial. In the eyes of the Élysée Palace and the military high command, on the other hand, the war against distant and fanatical enemies justifies the primacy of military operations over the uncertain recourse to the French justice system.

The In Amenas affair clearly illustrates this tension. On January 16, 2013, some thirty terrorists from the El-Mouaguiine Biddam katiba (Those Who Sign in Blood), dissidents of Al-Qaeda in the Islamic Maghreb (AQIM) led by Mokhtar Belmokhtar, attacked a massive gas complex located in Tigantourine, about sixty kilometers from In Amenas, in southern Algeria. Hundreds of employees and expatriates were taken hostage. The Algerian army launched a raid that resulted in a terrible toll: in addition to the thirty or so attackers killed, thirty-eight civilians died during the fighting, including a Frenchman, Yann Desjeux. This former special forces soldier, who had become the site’s deputy head of security, managed to save several hostages before being executed.

Several countries of origin of the victims, including the United Kingdom, the United States, Norway, and France, have launched legal proceedings. In Paris, the preliminary investigation is being conducted by the DCRI (Directorate General of Internal Security). A formal judicial inquiry, opened in January 2014, was then entrusted to Judge Laurence Le Vert, a key figure in the Saint-Eloi gallery, which houses anti-terrorism judges at the Palais de Justice (Paris courthouse). The family of Yann Desjeux, along with a French nurse, Murielle Ravey, a survivor of the attack, and three other French employees who were held hostage, have joined the proceedings as civil parties. They suspect, in particular, that the Algerian authorities are withholding information about what really happened in In Amenas, where there were numerous security lapses.

Identifying the perpetrators of the attack is relatively easy, since Mokhtar Belmokhtar’s group claimed responsibility in a video, presenting it as a reprisal against the French military operation “Serval,” launched in Mali a few days earlier and supported by the Algerians. Belmokhtar is one of the most wanted terrorist leaders in the Sahel—in the eyes of the French, one of the main high-value terrorists to eliminate. He has been terrorizing the region for years, carrying out a series of hostage-takings and attacks, often linked to smuggling. Once affiliated with AQIM, he has already escaped several French and American raids. (…)

But a judge cannot rely solely on these fragments of information to advance the investigation. Laurence Le Vert must reconstruct the precise sequence of events, authenticate the true causes of Yann Desjeux’s death, assess any potential Algerian responsibility, identify all members of the commando, and prosecute the surviving attackers and their leaders. Several terrorists have been taken prisoner. Interrogated by the Algerians and the FBI, three of them provided valuable information about the organization of the attack and its participants, which was passed on to the French justice system as well as other relevant countries. This information notably concerns the preparations carried out in Libya and the various leaders who oversaw the operation, including the Algerian Mohamed Lamine Bencheneb, a mathematics graduate killed during the raid, and Mokhtar Belmokhtar, who remains at large.

For his part, General Pierre de Villiers, Chief of the Defence Staff, interviewed [on Europe 1] in October 2014, mentioned eight identified and already effectively hunted individuals: “(…) We have neutralized seven of them. There is only one left and we will get him.” This is obviously Mokhtar Belmokhtar, who is blamed for other attacks – the suicide bombings in Arlit and Agadez in Niger, in May 2013, and the one committed against a French army unit near Gao, in Mali, on July 14, 2014, which killed a legionnaire and wounded six soldiers.

General de Villiers is not speaking lightly. For months, several of the “One-Eyed’s” (Belmokhtar’s) close associates have indeed been eliminated on orders from the Élysée Palace: Abou Moghren Al-Tounsi, at the end of September 2013; Fayçal Boussemane and the Mauritanian Al-Hassan Ould Al-Khalil, alias Jouleibib, Belmokhtar’s son-in-law and spokesman, in November 2013; Omar Ould Hamaha, known as Red Beard, Belmokhtar’s right-hand man, in March 2014; Abou Bakr Al-Nasr, known as the Egyptian, a weapons specialist, very active in Benghazi, Libya, killed in April 2014. Another of the One-Eyed’s lieutenants, Ahmed Al-Tilemsi, would be killed in December 2014; He was suspected of being one of the main perpetrators of the kidnapping of Vincent Delory and Antoine de Léocour in Niamey in January 2011.

General de Villiers’ statements provoked strong reactions at the Paris courthouse. “We learned, somewhat furiously, through the media, that individuals suspected of involvement in terrorism cases had been captured and neutralized by the French army ,” lamented Juliette Le Borgne, former prosecutor at the anti-terrorism unit. ” Our legal objective is to keep these people alive to bring them to justice. But that is not the objective of the French army. We simply want to know the truth, for the families.”

Equally outraged to see the military carrying out their own summary justice, Judge Laurence Le Vert immediately summoned General Pierre de Villiers for questioning. The two logics, military and judicial, clash, and it seems impossible to reconcile them. At the Élysée Palace, François Hollande clearly approves of military operations classified as “Defense Confidential” aimed at eradicating the leaders of terrorist groups, without being hampered by the cumbersome legal processes. Whether in the Sahel or, now, in Syria and Libya, he has become entangled in the machinery of war. Justice has taken a back seat.

See more news from Le Monde

READ MORE FRENCH NEWS AT: 21st CENTURY WIRE FRANCE FILES


Source: https://21stcenturywire.com/2025/11/24/candace-owens-and-what-if-she-was-right/

Palantir complicity in deadly Israeli pager attack on Lebanon exposed



A new biography reveals how Palantir deployed engineers to expand operations in Tel Aviv and supported deadly tech-driven military aggression in Lebanon.

Al Mayadeen English
December 10th 2025

A newly released biography has revealed that the US-based AI surveillance company Palantir Technologies played a direct role in "Israel’s" 2024 “pager and walkie-talkie” terrorist attacks in Lebanon.

The disclosure appears in "The Philosopher in the Valley: Alex Karp, Palantir, and the Rise of the Surveillance State," a new biography of Palantir CEO Alex Karp, authored by New York Times journalist Michael Steinberger. 

According to the book, "Israel’s" Mossad had been utilizing Palantir’s technology even before the escalation of aggression on Gaza and Lebanon in 2024. However, following the events of October 7, Steinberger writes, "Israel’s" Shin Bet and military “sought to obtain Palantir’s software,” prompting the US firm to expedite deployment. 

“The demand for Palantir’s assistance was so great that the company dispatched a team of engineers from London to help get Israeli users online,” Steinberger writes.

He adds that Palantir went as far as renting an additional floor in its Tel Aviv office to train Israeli intelligence analysts and expand operational capacity.

Deployed in 'Israel’s' terrorist pager attack on Lebanon

Palantir’s systems were reportedly used in a range of military operations, both in Gaza and Lebanon. Most notably, the company’s technology was deployed during "Operation Grim Beeper," where "Israel" remotely detonated booby-trapped pagers and walkie-talkies, claiming that they are carried by members of Hezbollah. 

The explosions, which occurred on September 18-19, 2024, killed at least 42 people, including two children, and injured more than 3,400 others, many suffering life-altering wounds.

Netanyahu himself later claimed the occupation’s responsibility, mocking international law, which was then crowned by a golden pager gifted to US President Donald Trump. What followed was a brutal Israeli war on Lebanon, the assassination of Sayyed Hassan Nasrallah and Sayyed Hashem Safieddine, and relentless aggression even after the ceasefire deal was reached on November 27, 2024.

The attacks were condemned globally. The United Nations described them as war crimes, while former CIA Director Leon Panetta called them “a form of terrorism.”

According to Steinberger, Palantir was directly involved in facilitating the technology used in these attacks.

US role and Palantir’s entanglement

The revelations further implicate the United States in the assault. US President Donald Trump later acknowledged that the attacks were conducted with his approval.

The revelations have intensified scrutiny of Palantir’s deepening involvement in "Israel’s" wars. Francesca Albanese, UN Special Rapporteur on human rights in the occupied Palestinian territory, has cited the company in her documentation of what she terms the genocide in Gaza. 

She noted that Palantir declared a “strategic partnership” with "Israel" in early 2024 and even held a board meeting in Tel Aviv “in solidarity". In response to criticism that the company’s technology contributed to the killing of Palestinians, Karp said in April 2025, “Mostly terrorists, that’s true.” 

Albanese stated that such remarks reveal “executive-level awareness of the unlawful use of force” and a clear willingness by Palantir leadership to remain complicit in ongoing violations.

Global implications

Adding to the alarm, former Mossad chief Yossi Cohen recently stated that "Israel" maintains similar “booby-trapped and spy-manipulated equipment” in “all the countries you can imagine.” 

Analysts argue that Palantir’s participation in the 2024 pager attacks makes these remarks particularly disturbing, given the company’s central role in US and global surveillance infrastructure. Its technology is currently used across various sectors, from law enforcement and immigration to military targeting and intelligence operations.

The book’s revelations place Palantir at the center of mounting international criticism over corporate complicity in war crimes and deepen concerns about the militarization of artificial intelligence in the service of Israeli occupation and aggression.

 


Source: https://english.almayadeen.net/news/technology/palantir-complicity-in-deadly-israeli-pager-attack-on-lebano

Somali president says Somaliland accepted Palestinian resettlement in exchange for Israel’s recognition

 


Israel's recognition followed months of reports linking Somaliland to US-Israeli discussions on Palestinian resettlement from Gaza and potential military access near the Red Sea


The Cradle
DEC 31, 2025

Somali President Hassan Sheikh Mohamud said Israel’s recognition of Somaliland was “unexpected and strange,” warning that the move carries implications for Palestinians in Gaza, in comments to Al Jazeera on 31 December.

Speaking from Istanbul, Turkiye, he outlined Somalia’s concerns and said Israel’s decision was abrupt and destabilizing.

Mohamud said that Somaliland has pursued its secessionist claim for decades without international recognition, noting that “no one country in the world has recognized it,” while Somalia has sought reunification “in a peaceful manner,” making Israel’s move, after 34 years, “very unexpected and strange.”

According to Mohamud, Somali intelligence indicates Somaliland accepted three Israeli conditions in exchange for recognition. He listed them as the resettlement of Palestinians, an Israeli military base on the Gulf of Aden coast, and accession to the Abraham Accords.

In a speech delivered on 28 December, Abdul Malik al-Houthi, the leader of Yemen’s Ansarallah, said that any Israeli footprint in Somaliland would be treated as a legitimate “military target” by the Yemeni Armed Forces.

Mohamud said there is already “a certain level” of Israeli presence in Somaliland, describing the recognition as the public normalization of what had been happening covertly, adding that Israel’s presence “is not for peace,” and warned of plans to forcibly displace Palestinians to Somalia.

Mohamud also pointed to Israel’s interest in controlling strategic waterways linking the Red Sea, the Gulf, and the Gulf of Aden, as part of a wider Israeli push across West Asia and the Mediterranean.

A 20-point plan issued by Donald Trump ahead of a Gaza ceasefire said “no one will be forced to leave Gaza,” while allowing voluntary departure and return.

However, Mohamud said Israel has continued to explore displacement options, citing reports of mysterious flights to South Africa.

Israeli Channel 12 reported in February 2025 that Morocco, Puntland, and Somaliland were being considered under Trump’s plan to forcibly relocate Palestinians expelled from Gaza, as he reiterated his intent for the US to take “ownership” of the strip while seeking political incentives tied to recognition and strategic influence.

The Somali leader gave a joint news conference with Recep Tayyip Erdogan, both of them warning that the recognition could destabilize the Horn of Africa.

Israel’s move was rejected by most members of the UN Security Council at an emergency meeting in New York.

The US was the sole member defending Israel, while stressing that its own position on Somaliland remained unchanged.

Israel formally recognized Somaliland on 26 December, becoming the first country to do so since the region declared independence in 1991, a move announced by Israeli Prime Minister Benjamin Netanyahu and framed as part of cooperation “in the spirit of the Abraham Accords.” 

The decision triggered swift regional condemnation, with Somalia rejecting it outright and Egypt, Turkiye, and Djibouti warning of destabilizing consequences for the Horn of Africa. 

The recognition followed months of reports linking Somaliland to US-Israeli discussions on Palestinian resettlement from Gaza and potential military access near the Red Sea, claims that both Somali and Somaliland authorities had previously denied.

 


Source: https://thecradle.co/articles/somali-president-says-somaliland-accepted-palestinian-resettlement-in-exchange-for-israels-recognition 

Israel's untold role in the Venezuelan crisis

 



Saruman 
Sep 29, 2025

 The United States is nearing an unprecedented military confrontation with Venezuela. The crisis escalated earlier this month following a U.S. drone strike that killed 11 suspected members of the Venezuelan gang Tren de Aragua, the first such attack in Latin America since the 1989 invasion of Panama. This was followed by another attack on September 15, 2025, that killed three suspected drug traffickers.

Days later, Venezuelan F-16s flew over U.S. warships, prompting warnings from the Pentagon and threats from President Donald Trump to shoot down any aircraft that approached. Since then, Washington has deployed its largest naval presence in the Caribbean in decades, including 4,500 sailors and marines, destroyers equipped with Tomahawk missiles, submarines, an amphibious assault ship, and 10 F-35s stationed in Puerto Rico.

This confrontation comes in the wake of the controversial Venezuelan elections of July 2024, widely condemned as fraudulent, in which opposition candidate Edmundo González claimed victory, but the electoral council declared Nicolás Maduro the winner. Jewish political scientist Steven Levitsky described the official results as “one of the most egregious electoral frauds in modern Latin American history.” The protests left at least 22 dead and more than 2,000 detained.

Once Donald Trump returned to office, his administration intensified sanctions and terrorism designations, labeling the Tren de Aragua and the Cartel of the Suns as narco-terrorist organizations and invoking the Foreign Enemies Act against Venezuelan nationals linked to these groups.

The roots of the hostility go back to Hugo Chávez’s rise to power in 1999, his survival of a US-backed coup in 2002, and decades of escalating sanctions, accusations, and regime-change attempts. Analysts see Trump’s current escalation as a resurgence of the Monroe Doctrine, Washington’s traditional claim to hemispheric hegemony.

However, what makes the current crisis uniquely explosive is the deepening of Venezuela’s ties with Russia, which signed a sweeping 10-year strategic agreement with Maduro in May 2025, and with China, which openly opposed US naval development. Venezuela, with the world’s largest proven oil reserves (300 billion barrels, 17% of the global total), has become not only a prize in energy geopolitics but also a node in the emerging Moscow-Beijing-Caracas axis.

However, beneath the surface of this escalating military confrontation lies a neglected dimension: the Jewish factor in US-Venezuela relations. Israel's strategic concerns have played a significant role in shaping US policy toward Caracas. As Venezuela has solidified its position as the most consistently anti-Zionist country in South America, Jewish factions within the US foreign policy establishment have increasingly viewed Caracas as a threat that extends far beyond traditional hemispheric security concerns.

The Anti-Zionist Evolution of Venezuela Under Chávez

The deterioration of relations between Venezuela and Israel accelerated during the Second Intifada, when the Chávez government sponsored demonstrations in support of the Palestinian cause. The first direct attack against the Venezuelan Jewish community occurred in May 2004, when the Sephardic synagogue Tiferet Israel in Caracas was attacked following a pro-Palestinian demonstration supported by the government.

The situation worsened dramatically during the 2006 Lebanon War, when Chávez accused Israel of genocide. In August 2006, Venezuela withdrew its ambassador from Israel and subsequently declared: “Israel has gone mad. They are massacring children, and no one knows how many are buried.”

Venezuela’s complete break with Israel occurred on January 14, 2009, during Operation Cast Lead in Gaza. Chávez described the Israeli military offensive as a “cruel persecution of the Palestinian people, directed by the Israeli authorities.” The Venezuelan Foreign Ministry announced the severing of diplomatic relations, stating that the measure was taken “given the inhumane persecution of the Palestinian people by the Israeli authorities.”

Following this diplomatic break, Venezuela officially recognized Palestine on April 27, 2009, becoming the first country in the Americas to establish formal diplomatic relations with the Palestinian Authority.

Likud in Caracas: The Israeli Hand Behind the Venezuelan Opposition

The Venezuelan opposition has adopted a radically different approach in its relations with Israel. A clear example of this is María Corina Machado, leader of the liberal party Vente Venezuela, who in July 2020 signed a formal cooperation agreement with the Israeli ruling party, Likud.

The agreement promised collaboration on “political, ideological, and social issues, as well as strengthening cooperation on strategic, geopolitical, and security matters.” It explicitly stated its objective of “bringing the people of Israel and the people of Venezuela closer together, promoting Western values ​​of freedom, independence, and a market economy.”

Machado described this as sending “a clear message to Nicolás Maduro” and indicated that if she came to power, she would restore diplomatic relations with Israel.

Israel’s Recognition of Juan Guaidó

Israel was one of the first countries to recognize Juan Guaidó as interim president of Venezuela during the 2019 presidential crisis. Prime Minister Benjamin Netanyahu announced Israel’s recognition on January 27, 2019, stating that Israel “joins the United States, as well as Canada, most South American countries, and European nations.”

According to Axios, the Trump administration had specifically asked Israel to publicly support the regime change campaign against Maduro.

Guaidó thanked Netanyahu for the recognition with rhetoric that explicitly links Venezuela’s struggle to the liberation from the Holocaust: “Seventy-four years ago, the Auschwitz concentration camp was liberated, and today, just as our country is also fighting for its freedom, we thank the Prime Minister of Israel, Benjamin Netanyahu, for his recognition and support.”

Venezuela’s Strategic Alliance with Iran

Venezuela has forged strong ties with the Islamic Republic of Iran since 1999, creating what both countries describe as an “axis of unity” against U.S. imperialism. Chávez’s first visit to Iran in 2001 marked the beginning of what would become a strategic alliance based on shared resistance to the overreach of the Judeo-American empire in their respective spheres of influence.

The relationship deepened after Mahmoud Ahmadinejad's election as president of Iran in 2005. Through numerous exchanges, Chávez and Ahmadinejad established hundreds of bilateral agreements. Their alliance grew so close that, in 2006, Chávez promised to "support Iran at any time and under any conditions."

During a speech at the University of Tehran in 2010, Chávez warned: "If the American empire manages to consolidate its dominance, humanity will have no future. Therefore, we must save humanity and end the American empire."

The Hezbollah Connection

The alliance between Iran and Venezuela has expanded to include Hezbollah, a longtime Iranian ally that has raised security concerns for Empire Judaica. US officials claim that Iran and Hezbollah maintain operational networks in Venezuela that facilitate drug trafficking and money laundering. These networks reportedly collaborate with Venezuelan military elites from the Cartel of the Suns in cocaine trafficking, and Hezbollah allegedly acts as a primary source of funding and money laundering for narco-terrorist groups like the Tren de Aragua.

Security experts say Hezbollah operates in Venezuela through clan structures embedded in the Maduro government’s illicit economy. The Venezuelan airline Conviasa operates regular flights between Caracas, Damascus, and Tehran, which Hezbollah reportedly uses to transport operatives, recruits, and cargo in and out of the region.

These accusations of Hezbollah infiltration further fueled Maduro’s narrative that his internal opposition is part of a broader Zionist conspiracy.

Under Maduro’s rule, relations between Venezuela and Iran have continued to strengthen: Tehran has supplied gasoline shipments during fuel shortages, cooperated on military matters (including drone technology), provided assistance in evading sanctions, and signed a multi-billion-dollar trade and investment agreement.

Maduro’s accusations regarding “international Zionism”

Following the controversial 2024 Venezuelan elections, Maduro repeatedly blamed “international Zionism” for the country’s internal problems. In August 2024, after widespread protests over alleged electoral fraud, Maduro claimed that his opposition was supported and funded by international Zionist networks.

“All the communication power of Zionism, which controls all social media, satellites, and all the power behind this coup,” Maduro declared in a televised address. He also called Argentine President Javier Milei, who currently leads the most pro-Semitic government in Latin America, a “Zionist” and a “social sadist.”

Maduro’s comments drew sharp criticism from Deborah Lipstadt, then U.S. Special Envoy to Monitor and Combat Anti-Semitism, who accused him of reviving classic anti-Semitic tropes about Jews controlling global affairs.

“Maduro’s absurd claim that Jews are behind the election protests in Venezuela is anti-Semitic and unacceptable,” Lipstadt tweeted. “The Venezuelan people have taken to the streets to peacefully demand a recount of their votes. We reject all forms of anti-Semitism, and the use of these kinds of age-old clichés fuels hatred against Jews in Latin America and around the world.”

The enduring neoconservative order

The US approach to Venezuela cannot be understood without acknowledging the influence of neoconservative ideology on US foreign policy over the past 30 years. Neoconservatism posits that the United States is an exceptional political system that should expand its model of democracy across the globe. But this is only a small part of it. Its ultimate goal is to make the world a safe haven for Zionist supremacy, an ideological current marked by significant Jewish overrepresentation.

Stephen McGlinchey, a senior lecturer in International Relations at the University of the West of England, observed: “The central tenet of Bush’s neoconservative foreign policy package, revolutionary democratization, is intrinsically linked to Israel’s security.” Under this Jewish supremacist framework, any country that adopts a principled anti-Zionist stance is seen as a threat to Jewish-American interests.

Like many Jewish movements, neoconservatism relies on subservient Gentiles to implement its agenda. Currently, Secretary of State Marco Rubio, a veteran interventionist with his sights set on rebuilding Latin America in the image of the dysfunctional United States, is leading the campaign to overthrow the Maduro government. Rubio, a proponent of regime change, has maintained close ties with Venezuelan opposition figures such as María Corina Machado, pressing for harsher sanctions and greater diplomatic isolation.

Venezuela’s affinity with Iran—the bête noire of global Jewry—further motivates Rubio and his Jewish allies to implement punitive measures against Caracas. Any country that deviates from this consensus becomes a new target for regime change.

The collapse of US-Venezuela relations represents a complex intersection of hemispheric hegemony, energy geopolitics, and Jewish concerns. While oil reserves and great power competition offer the obvious explanations for US hostility, the Israeli factor adds a crucial dimension that has been systematically underestimated in policy analysis.

By emerging as South America’s most reliable anti-Zionist country, aligning itself with Iran, and tolerating Hezbollah’s presence, Venezuela has provoked the ire of Jewish policymakers in Washington, who interpret its challenges to Israel as pretexts for expanding American power in defense of Zionist objectives.

Taken together, these dynamics reveal that Venezuelan defiance is not perceived in Washington simply as a hemispheric issue, but as part of a broader ideological battle linked to Israel’s security and the global reach of Zionist influence. With Jewish interests shaping foreign policy at the highest levels, defending genuine American interests becomes impossible.

 

Source: https://elcontacto.cl/el-papel-no-contado-del-pueblo-judio-en-la-crisis-venezolana/ 

sexta-feira, 19 de dezembro de 2025

Why Was the Israeli Vaccine Study Really Deleted?



And why is a former Human Genome Project team leader trying to downplay these uncomfortable facts?

 

Dec 13, 2025

A deleted Israeli study claimed to detect Pfizer vaccine mRNA in blood, placenta, and semen. More interesting: they detected it in 50% of unvaccinated women, too. I reported here!

Kevin McKernan - former R&D team leader for the Human Genome Project - attempted to dismiss concerns about the study’s primers cross-reacting with human DNA.

 

Curious response from a former Human Genome Project team leader - sloppy formatting (no spaces, inconsistent capitalization) paired with ad hominem attacks (”incoherent,” “never performed PCR,” “polarizing,” implying lack of intelligence) rather than addressing the actual science.

Besides this, his four arguments don’t hold up:

Point 1: “Primers don’t match on 3’ end”

Factually wrong. The nested forward primer (ACTTCACCGGCTGTGTGATT) shows a perfect 20/20 match to human Chromosome 1 (NC_000001.11) with q_start=1, q_end=20. The entire primer, including the 3’ end, aligns perfectly. E-value: 0.008.

Point 2: “Different chromosomes = impossible to amplify human DNA”

This assumes the SARS-CoV-2 genome is distinct from human sequences. But is it?

Edward Holmes - co-author of the original genome publication - confirmed that MN908947.1 contained human DNA:

The genome was assembled via MEGAHIT from mixed metagenomic reads - never from isolated viral material. Both the CDC (https://x.com/USMortality/status/1840501046910550277) and RKI (https://x.com/USMortality/status/1876650231850267129) have confirmed no viral genetic material was ever sequenced in isolation.

If “spike” sequences were derived from human reads misassembled as “viral,” then detecting them in unvaccinated humans isn’t cross-reactivity - it’s detecting endogenous human sequences that were mislabeled as viral from the start.

Point 3: “Sanger sequencing confirmed spike”

Circular logic. If spike was originally derived from human reads during genome assembly, confirming you found “spike” proves nothing about its origin. Also, where’s the raw data for public scrutiny?

Point 4: “Pre-2020 controls were negative”

Where’s the data? How many samples? What tissue types? Same PCR protocol?

Even if true - the sequence “appearing” in late 2019 coincides with when they created the reference genome from metagenomic assembly. That’s not proof of viral emergence.

The Real Question: Why Deleted?

The study wasn’t retracted - it was deleted. No DOI, no retraction notice, no explanation.

A retraction requires a formal process with a public record. Deletion leaves no trace.

If the problem were simply “bad primer design,” a retraction notice would suffice. But what if the study accidentally demonstrated something far more inconvenient?

50% of unvaccinated women tested positive for “spike” sequences. What if they weren’t detecting vaccine contamination or primer cross-reactivity - but rather human sequences that were incorrectly labeled as “viral” when the SARS-CoV-2 genome was first assembled in 2020?

Perhaps the study was deleted not because it was wrong, but because it was accidentally right about something it wasn’t supposed to find.

Background: Is the SARS-CoV-2 Genome Valid?

For those unfamiliar with my ongoing analysis:

1. The original SARS-CoV-2 genome (MN908947) was assembled from short metagenomic reads using MEGAHIT - a de Bruijn graph assembler that may create artificial contigs from k-mers. (more)

2. Early versions contained confirmed human DNA contamination.

3. No single long read (or at least several well overlapping long reads) spans the full 29,903 bp genome, that include the exact start and end.

4. All subsequent validation uses PCR primers derived from this unverified sequence (circular logic).

5. CDC and RKI confirm no viral material was ever sequenced in isolation.

👉 The deleted Israeli study may have inadvertently provided another data point supporting this hypothesis!


Source: https://www.usmortality.com/p/why-was-the-israeli-vaccine-study

quarta-feira, 17 de dezembro de 2025

Venezuela responds to Trump’s oil blockade


The US president has demanded Caracas “return stolen assets” or face the wrath of the American naval armada 
 
RT
17 Dec, 2025  

The US president has demanded Caracas “return stolen assets” or face the wrath of the American naval armada

Venezuela has denounced US President Donald Trump’s oil blockade on the country, saying his “interventionist and colonialist” rhetoric proves Washington’s long-standing plan to seize Venezuelan natural resources.

Trump had announced the move in a Truth Social post on Tuesday, describing it as “a total and complete blockade of all sanctioned oil tankers going into, and out of, Venezuela.”

In an official statement released late Tuesday, Venezuelan Vice President Delcy Rodriguez said Trump’s remarks revealed the “true intention” of the United States “to take over the oil, land, and minerals of Venezuela.”

The government rejected Trump’s claim that Venezuela had “stolen” assets from Washington and denounced his rhetoric as “interventionist and colonialist.” The statement accused the US president of violating international law, free trade, and freedom of navigation by ordering US naval forces in the Caribbean to prevent “sanctioned tankers” from entering or leaving Venezuelan waters.

“Through his social media statements, the president of the United States assumes that Venezuela’s oil, land, and mineral wealth belong to him,” the statement said. “On that basis, he seeks to impose a naval military blockade with the objective of robbing the riches that belong to our homeland.”

Rodriguez said Washington’s actions were part of a “gigantic campaign of lies and manipulation” aimed at justifying the appropriation of the country’s natural resources. She added that the US had always sought to dominate Venezuela economically and politically, regardless of changes in administration.

The government said Venezuela would exercise its rights under international law, its constitution, and the UN Charter, reaffirming its sovereignty over its natural resources and its right to free navigation and commerce in the Caribbean and beyond.

“Venezuela will never again be a colony of an empire or any foreign power,” the statement said.

Since September, the US military has killed more than 80 people in attacks on alleged cartel boats, which Trump claimed were being used by the Venezuelan government to “flood” America with narcotics. Venezuela has denied any involvement in drug trafficking and said the strikes were part of a regime change plot to plunder the country’s natural resources.


Source: https://swentr.site/news/629536-venezuela-trump-oil-threat/

sábado, 13 de dezembro de 2025

Over 700 Israeli ceasefire violations: nearly 400 Palestinians killed since October



The Cradle
Dec 10, 2025

Israel has carried out at least 738 violations of the Gaza ceasefire, killing nearly 400 people since October, the Government Media Office in the strip revealed in a report on 9 September. 

“We confirm that the Israeli occupation has continued, since the ceasefire came into effect on 10 October 2025, until 8 December 2025 (for a period of 60 days), to commit serious and systematic violations of the agreement, in clear violation of international humanitarian law,” the media office said. 

“During this period, the competent government authorities recorded 738 violations of the agreement,” it added, revealing that at least 386 Palestinian civilians have been killed by Israeli airstrikes, drone attacks, artillery bombardment, and gunfire. 

Among the dead are scores of women, children, and the elderly. Nearly 1,000 Palestinians have been injured, the media office went on to say. 

The media office’s tally reveals that there have been 205 Israeli shootings targeting civilians, 37 incursions into populated areas, 358 bombardments targeting civilians and homes, and 138 detonations of buildings and infrastructure.

It added that an average of only 226 fuel and aid trucks have entered Gaza per day, out of the 500 required in the ceasefire deal – constituting just 10 percent of the agreed-upon amount.

“Only 13,511 trucks out of the 36,000 trucks supposed to enter Gaza have actually done so during the 60-day period.”

By the start of last month, Tel Aviv had only allowed in 28 percent of the aid that was meant to enter the strip as part of the deal, the Government Media Office said in November. 

This includes essential equipment urgently needed for rubble removal operations.

There are currently 68 million tons of rubble in Gaza due to Israel’s genocidal war and systematic destruction of infrastructure, according to the UN Development Program (UNDP).

Hamas has warned that talks to implement phase two of the Gaza ceasefire deal cannot take place while Israel continues to violate the first phase of the agreement.

“The occupation has not implemented any of its basic obligations in the first stage, as it still closes the Rafah crossing, prevents the entry of tents and caravans, reduces humanitarian aid, and continues its crimes of killing and demolition within the yellow line. These practices are a continuation of the aggression that was supposed to stop immediately after the start of the agreement, noting that they continue without any real commitment,” senior Hamas official Hussam Badran said on 9 September.


Source: https://thecradle.co/articles/gaza-officials-reveal-nearly-400-palestinians-killed-since-october-in-over-700-israeli-ceasefire-violations

At least 60,000 murdered in Sudanese city, which resembles ‘a slaughterhouse’


 
December 5th, 2025

The Sudanese city of El Fasher resembles a “massive crime scene”, with large piles of bodies heaped throughout its streets as the paramilitary Rapid Support Forces (RSF) work to destroy evidence of the scale of their massacre, analysis indicates.

Six weeks after the RSF seized the city, corpses have been gathered together in scores of piles to await burial in mass graves or cremation in huge pits, according to satellite evidence.

With the capital of North Darfur state still sealed off to outsiders, including UN war crimes investigators, the satellite evidence has revealed a network of newly dug incineration and burial pits thought to be for the disposal of large numbers of bodies.

While the final death toll of the massacre remains unclear, British MPs have been briefed that at least 60,000 have been murdered in El Fasher.

Sarah Champion, chair of the House of Commons international development select committee, said: “Members received a private briefing on Sudan, at which one of the academics stated, ‘Our low estimate is 60,000 people have been killed there in the last three weeks’.”

As many as 150,000 residents of El Fasher remain unaccounted for since the city fell to the RSF. They are not thought to have left the city and this distressing development comes amid increasingly gloomy speculation about their fate.

Nathaniel Raymond, director of the Yale Humanitarian Research Lab, which has been closely analysing satellite images of El Fasher, said the city was eerily empty, with once-bustling markets now desolate.


 El Fasher has been the worst battleground of Sudan’s brutal civil war.


Yale’s latest analysis suggests marketplaces are now so unused that they are becoming overgrown and that all the livestock appears to have been moved out of the city, which had 1.5 million inhabitants before the war began in April 2023.

“It’s beginning to look a lot like a slaughterhouse,” said Mr Raymond.

No expert or agency has been able to explain the whereabouts of the tens of thousands of residents who have been missing since El Fasher – the army’s last major stronghold in the region – was overrun on October 26th after the RSF’s brutal 500-day starvation siege.

The Guardian has spoken to sources who describe El Fasher residents being held in detention centres in the city, though the numbers still detained are small.

RSF officials had pledged to allow the UN into El Fasher to deliver aid and investigate atrocities, but the city remains out of bounds for humanitarian organisations as well as UN officials.

Aid convoys are understood to be on standby in nearby towns and cities as negotiations for the RSF to give safety guarantees continue. So far the paramilitary group, now in its third year of civil war with Sudan’s armed forces, has refused.

A UN source said: “There needs to be a security assessment before we can plan on sending assistance. Right now, there is no guarantee of safe passage or protection of civilians, aid workers or humanitarian assets.”

Despite the uncertainty over how many residents might be alive inside El Fasher, the need for help to reach the city is deemed critical, with “staggering” levels of malnutrition reported among those who had escaped. International experts have declared the city to be in famine.

Mr Raymond said some residents, with whom his team had now lost touch, had contacted them within the first two days of the attack alleging that up to 10,000 people had been killed.

Human rights experts now believe El Fasher is likely to be the worst war crime of the Sudanese civil war, which is already characterised by mass atrocities and ethnic cleansing.

The war between the Sudanese army and the RSF erupted in April 2023 when the two forces, then partners in power, clashed over plans to integrate their forces.

Over 32 months of ruinous war, the country has been torn apart, with as many as 400,000 people killed and almost 13 million displaced. The conflict has caused the world’s biggest humanitarian crisis.

Meanwhile, there have been renewed calls for a thorough investigation into an RSF attack on the Zamzam displacement camp 12km south of El Fasher six months earlier.

A new report by Amnesty International documents how the RSF targeted civilians, took hostages and destroyed mosques and schools during a large-scale attack on Zamzam camp. It has called for the RSF to be “investigated for war crimes”.

Source: https://www.irishtimes.com/world/africa/2025/12/05/at-least-60000-murdered-in-sudanese-city-which-resembles-a-slaughterhouse/