Los Virólogos

Stefan Lanka
Wissenschafftplus
2020

"Los iniciadores de la crisis de Corona han sido claramente identificados: los virólogos que afirman la existencia de virus causantes de enfermedad están cometiendo fraude científico y deben ser procesados" 

 

Descripción general 

La ciencia y el método científico son herramientas importantes que ayudan a identificar y resolver nuestros desafíos. La ciencia tiene reglas muy claras: las afirmaciones deben ser probadas, deben ser transparentes, comprensibles y verificables. Solo las declaraciones que son verificables pueden llamarse científicas, todo lo demás cae dentro del ámbito de la fe. Las cuestiones de fe no deben presentarse como hechos científicamente probados para derivar o justificar medidas gubernamentales. 

Los enunciados científicos deben ser refutables y falsificables para poder reclamarlos como científicos. El primer deber prescrito de todo científico es comprobar estrictamente sus propias afirmaciones y tratar de refutarlas. Cuando la refutación fracasa de forma claramente documentada y a través de experimentos de control, solo entonces una declaración puede llamarse científica. 

Todas las medidas de Corona emitidas por gobiernos y autoridades están reguladas en última instancia por la ley, en Alemania, la Ley de Protección contra Infecciones (IfSG). La ley les da la apariencia de legitimidad pero no les da una justificación. Con el § 1 ifSG, por ejemplo, el marco legal está destinado a someter a la población a las reglas de la ciencia. La regla más importante de la ciencia son los intentos documentados y fallidos de refutar la afirmación que se ha presentado como verdadera y científica. Todas las reglas científicas requieren el cumplimiento de las leyes del razonamiento y de la lógica. Si se ignora o se viola estas reglas, la declaración científica queda refutada, al igual que lo seria si fuera por un exitoso experimento de control.

La elección de palabras en todas las publicaciones sobre todos los virus patógenos demuestra que los virólogos no solamente violaron las leyes de la razón, la lógica y los principios vinculantes de la ciencia, sino que incluso ellos mismos refutan la existencia de virus patógenos. Si nos quitamos las gafas hipnóticas del miedo y leimos objetivamente lo que han escrito los autores, cualquier persona capaz de entender el inglés y que haya adquirido una comprensión de los métodos utilizados descubrirá que los virólogos han malinterpretado las secuencias genéticas normales como componentes virales y, al hacerlo, han refutado todo su campo de experiencia. (Nota: Sin embargo, esta confusión no se extiende a los virólogos que estudian a los fagos y a los llamados virus gigantes parecidos a los fagos). En el caso de las afirmaciones sobre la existencia del presunto virus SARS-CoV-2, esto es particularmente transparente". 

Ya que estos virólogos han violado claramente los requisitos científicos fundamentales, estos solo pueden describirse como estafadores de la ciencia. Y dado que el fraude científico no cae dentro de ninguna competencia actual en el derecho penal - hasta ahora no hay precedentes al respecto - propongo establecer el fraude laboral de los virólogos. Al pretender actuar científicamente cuando en realidad actuan de manera no científica, los virólogos cometen el fraude de no cumplir con el trabajo para el que fueron contratados. Por eso propongo que esto se establezca en los tribunales y en el derecho penal. Los departamentos gubernamentales pertinentes están llamados a enjuiciar a los pseudocientíficos fraudulentos para evitar que continúen llevando a cabo sus actividades anticientíficas, antisociales y peligrosas. Tan pronto como el primer tribunal de justicia establezca los hechos descritos en este artículo y condene al primer virólogo por fraude, se anunciará el fin de la crisis de Corona y, sellada judicialmente, la crisis se convertirá en una oportunidad para todos.  

 

Introducción 

 La humanidad se enfrenta a un gran desafío: Las disciplinas de la biología y la medicina han creado tendencias e impulsos que se auto-refuerzan. A consecuencia del miedo y de una perspectiva anti-vida, estas tendencias perturban y destruyen al medio ambiente, a las plantas, los animales, las personas y a la economía. La crisis de Corona es solo la punta visible de un iceberg en curso de colisión con todos. Una de las razones de este desafío es el materialismo, el intento de explicar la vida a través de modelos estrictamente materiales. Nuestro materialismo actual fue inventado en la antigüedad "post-socrática" como contrarreacción a la generación de miedo y el abuso de poder por parte de las religiones. Tal motivación fue humana y comprensible, pero ha tenido consecuencias dramáticas. La filosofía materialista ha traído consigo una dicotomía entre el bien y el mal, y en la biología, en la que se basa la medicina occidental (la opinión reinante), enfoques de tratamiento anti-vida (antibióticos, radiación, quimioterapia, desinfección, restricción de derechos básicos, vacunación, encierro, cuarentena, distanciamiento social, etc.). El medio ambiente, la economía y cada vez más personas se ven perjudicados por esta ideología. La teoría materialista del bien y el mal carece de base real y parte de suposiciones ya refutadas, pero de forma desapercibido ésta ha ido creciendo hasta convertirse en la religión más poderosa.

La teoría materialista de la vida dice que solo existen átomos, pero que no existe conciencia, no hay fuerzas espirituales ni ningún motor para crearlos y ponerlos en movimiento. Para poder explicar el cosmos y la vida de una manera puramente material, nuestra “ciencia” se ve obligada a reclamar una gran explosión, en el que todos los átomos que se separaron emergieron de la nada. Algunos átomos se tocarían accidentalmente y se formarían moléculas. Al unirse por casualidad, estas moléculas formaron una célula primordial, de la cual surgió toda la vida posterior a través de la lucha y la selección. Se dice que todo esto sucedió en un pasado lejano de períodos de tiempo inimaginables. El panorama se aleja del escrutinio científico y, por lo tanto, no debe describirse como científico. 

 Dejémonos de lado la física teórica con sus teorías cuánticas, que con esta mentalidad sueña con una inversión de capital cada vez mayor en cosas cada vez más pequeñas. Para tener una visión más clara de la vida comprensible a traves de experimentos sencillos, me gustaría señalar la sustancia misma de la que se compone la vida: la membrana de agua, la llamada membrana de tensión superficial que está formada por el agua dondequiera que entra en contacto con otras sustancias y siempre que se encuentra en un remolino, un movimiento en espiral. Aristóteles llamó esta sustancia 'éter' y el Dr. Peter Augustine la redescubrió en forma de sustancia original. Los fisiólogos botánicos  japoneses llamaron a esta sustancia agua-pi. Esta perspectiva que resulta del conocimiento del éter / sustancia original también permite que se reviva el principio presocrático, y que éste se vuelva concebible e imaginable: tanto a gran escala como a pequeña escala. Pensar en la teoría atómica complica o impide este tipo de concepcion y mundo de imaginación y, si no se conocen otras formas de pensar o si estas están mal vistas, incurrimos en suposiciones falsas. La biología y la medicina académica se basan en tal concepto erróneo. En 1848, cuando los efectos constructivos de la revolución francesa cobraban influencia en Alemania, los intentos de agitación fracasaron y se dio como resultado un dramático endurecimiento y deterioro de la vida política y social. En 1848 la persona decisiva para el desarrollo actual de la biología y la medicina seguía abogando por medidas humanas, lógicas y correctas para la "profilaxis epidémica", pero en los diez años siguientes se adaptó al endurecimiento y a las condiciones políticas cada vez más extremas. Hablamos de Rudolf Virchow, quien, en 1858, postuló la teoría celular de la vida y de todas las enfermedades. Esta teoría  de la patología celular carecía de base científica, basandose exclusivamente en la teoría atómica de Demócrito y Epicuro.

Rudolf Virchow suprimía los "hechos relevantes" de la embriología y la ciencia de los tejidos a lo largo de su vida para poder presentar y difundirr su nueva teoría celular como algo fáctico.

Sin embargo, este conocimiento de la embriología y la teoría de los tejidos, la teoría de los cotiledones de la vida, son un requisito previo imprescindible para comprender la vida, su desarrollo y, sobre todo, las enfermedades, la curación, las crisis curativas y los obstáculos para la curación. Rudolf Virchow afirmó de manera análoga a la teoría atómica que toda la vida proviene de una sola célula. La célula sería y la unidad de vida más pequeña, pero al mismo tiempo provocaría todas las enfermedades a través de la formación de supuestas toxinas patógenas, en latín virus. Esto sentó las bases para las teorías de genes, infecciones, inmunidad y cáncer, dentro de las cuales se explicarían la vida, la enfermedad y la curación. Si se sostiene que todos los procesos se derivan de interacciones materiales y que toda la vida surge de una célula, los seguidores de esta visión se ven obligados a mantener un diseño estructural y funcional de la vida, es decir, una sustancia hereditaria, y afirmar esto como hecho. La misma lógica forzada surge para las supuestas patógenas: la célula supuestamente produce virus (venenos que causan enfermedades) y los propaga dentro y fuera del cuerpo. Para que esto sea cierto, se debe reclamar un lugar dentro del individuo donde se creó este virus por primera vez. Una vez que esta forma de pensar se convierte en dogma, con exclusión de cualquier otra enseñanza, los puntos de vista distintos son difamados como acientíficos o conspirativos contra el Estado, y se excluye de entrada, otros modos de pensar el origen de las enfermedades. 

Esta lógica forzada sólo busca causas en los defectos materiales o malignidad material. Oculta el hecho de que la idea del virus como una enfermedad tóxica quedó refutada y abandonada en 1951, por lo cual, había que inventar otra idea el año siguiente: Los virus ya serían una colección de genes peligrosos. Sin embargo, no hay pruebas científicas viables para esta suposición hasta el día de hoy. La buena noticia es que la virología genética, que se hizo popular a partir de 1954, se queda refutada científicamente por sus propias declaraciones. Doy constancia de esta afirmacion al 100%. Lo apoyaré como virólogo, científico, ciudadano y como ser humano.

La transición de la virología de las toxinas a la virología genética actual

El concepto un veneno patógeno sigue siendo efectivo ya que todavía se afirma la existencia de peligrosas toxinas proteicas bacterianas en el cuerpo. También se afirma que son peligrosas las espiroquetas ('bacterias de sacacorchos') que supuestamente perforan desde un presunto punto de entrada, y recorren los nervios en hasta llegar al cerebro. Lo que los virólogos, médicos y periodistas científicos omiten es que la teoría de los virus como toxinas proteicas se tuvo que abandonar en el año 1951. Ese año se llevaron a cabo dos experimentos de control para demostrar la teoría del virus patógeno:

1. En lugar de exponer únicamente los tejidos supuestamente dañados por virus, los tejidos sanos también estuvieron expuestos a la putrefacción. Se descubrió que las proteínas producidas por la descomposición de tejido sano eran las mismas que las producidas por la descomposición de tejido "dañado por virus". Esto refutó la suposición del virus.

2. Además de esto, la antigua teoría se vino abajo por el hecho de que nadie podría encontrar o fotografiar algo diferente en personas o animales supuestamente infectados con un virus de lo que se encontraba o fotografiaba en sujetos sanos. Por cierto, esto sigue siendo el caso hoy en día.

La virología clínica, es decir, médica, se refutó a sí misma con estos  experimentos de control y se rindió con palabras de pesar, pero esto solo lo notaron los lectores atentos de revistas profesionales. Las campañas de vacunación en curso seguían siendo celebradas y promovidas por los manipuladores del poder, por lo que los medios de comunicación suprimieron la noticia. Las campañas de vacunación no se detuvieron a pesar de que los virus ya no sirvian de justificativo.  Esto también se debía al silencio de las autoridades sanitarias y de la 'comunidad científica'. Una vez que la virología se había invalidado, la biología y la medicina aún no propusieron otra explicación para lo que antes se había definido como brotes virales, dentro de la teoría celular puramente material.

Por lo tanto, se tuvo que idear una nueva teoría sobre la naturaleza de los virus. Los involucrados modelaron su pensamiento sobre estructuras fácticas llamadas fagos. Estos son producidos por bacterias cuando éstas son apartadas de su medio y se inhibe su intercambio vital con otras bacterias y microbios. Cuando era un joven estudiante, tuve la suerte de aislar una estructura así del mar y estudiar su estructura, su composición y su interacción con el medio ambiente. Esto me llevó directamente al campo de la virología, ya que suponía inocentemente que había descubierto una relación inofensiva virus / virus-huésped estable que, por lo tanto, podría permitirme estudiar el origen de los virus.  Treinta años después, se siguen descubriendo nuevos ejemplos de estas estructuras ahora denominadas "virus gigantes" y, además, se ha demostrado claramente que estas estructuras se encuentran al origen de los procesos con los que comienza la vida biológica. Algunos investigadores actualmente consideran que estas estructuras son parte del cuarto reino de la vida junto con las bacterias primordiales, las bacterias y los eucariotas.   

Estas estructuras conocidas como fagos y también como "virus gigantes" se consideran erróneamente comedores de bacterias. Pueden describirse como un tipo de espora que las bacterias y los organismos simples forman cuando sus condiciones de vida cambian de tal manera que ya no pueden reproducirse o sobrevivir de manera óptima. Este tipo de estructura siempre consta de una hebra de la denominada sustancia hereditaria ADN, que siempre tiene exactamente la misma longitud y exactamente la misma composición.  Este tipo de ADN siempre está encerrado por una membrana del material denso de donde emerge la vida biológica. Es por eso que los fagos o 'virus gigantes', mejor llamémoslos biontes, son fáciles de aislar, es decir, de cultivar y separar de los demás componentes de la vida.

De hecho, los fagos han sido la única fuente de ácido nucleico puro (ADN) en estudios bioquímicos durante décadas. El proceso de tomar y liberar ADN dentro y fuera de las bacterias, documentado en el microscopio electrónico, se interpretó como una infección. Completamente sin evidencia, se afirmó que los fagos atacan a las bacterias, las violan, les imponen su ácido nucleico y, como resultado, las bacterias mueren. En realidad, la situación es muy diferente. Solo las bacterias que son extremadamente endogámicas, es decir, que se reproducen constantemente sin tener contacto con otras bacterias o microbios, se transforman en un acto de metamorfosis en fagos circundantes.

Esta conversión se malinterpreta como la muerte de las bacterias por los fagos. Por otro lado, las bacterias que están recién aisladas de su entorno nunca se convierten en fagos y tampoco mueren si se les agregan fagos en cualquier cantidad. Ésta es también la razón por la que la terapia con fagos (a menudo citada como sustituto de los antibióticos para suprimir el dolor y otros síntomas), así como con cualquier otro envenenamiento, nunca funcionará en el sentido pretendido de matar bacterias.

 

La biología de fagos, los virus gigantes y la consiguiente  refutación de la teoría celular de la vida.

En el caso del alga (ectocarpus siliculosus), del cual aislé sus "virus gigantes", la situación es la siguiente: Las formas móviles del alga, los gametos y las esporas, buscan a los "virus gigantes" en su entorno con sus flagelos flexibles y los absorben. Las algas en crecimiento integran los ácidos nucleicos de los "virus gigantes" en sus propios cromosomas. Se ha observado que las algas con "virus gigantes"  presentan un mejor desarollo que las que no los tienen. Nunca se ha observado que las algas con "virus gigantes" estén en peores condiciones que las que no los tienen. Una y otra vez se encuentran nuevos y cada vez más asombrosos “virus gigantes” y van apareciendo más pruebas de que las bacterias y los microorganismos, las amebas y los organismos unicelulares surgen de los “virus gigantes” en los que se transforman de nuevo cuando ya no se dan sus condiciones de vida.

Evidentemente, los virus gigantes surgen alrededor de los ácidos nucleicos y a través de estos. Los ácidos nucleicos desarrollan actividades catalíticas, es decir, liberan energía de forma independiente, sintetizan más ácidos nucleicos, otras moléculas y sustancias y, por lo tanto, generan constantemente nuevas propiedades y capacidades. Las formas de ácido nucleico particularmente reactivas y diversas del ARN, ("El mundo del ARN"), que puede transformarse fácil y constantemente en ADN y viceversa, también surgen en el proceso de autoorganización de la vida, sin ninguna razón y causa científicamente accesible. La vida biológica que es visible para nosotros se materializa del agua. Se encuentran cada vez más organismos celulares cuyo genoma consiste en gran parte en los ácidos nucleicos de "virus gigantes". Con el descubrimiento de los fagos, que solo surgen durante la conversión de cultivos bacterianos extremadamente consanguíneos (incestuosos), y el descubrimiento de los virus gigantes que se mantienen, se agrandan y se metabolizan activamente, mas el descubrimiento de nuevos organismos que consisten en virus gigantes, tres cosas quedan demostradas hasta ahora:

 i. La teoría celular de que la vida biológica solo existe en forma de células y solo surge de las células ha sido refutada. 

 ii. La afirmación de que la vida biológica surgió en tiempos primordiales de una vez por todas ha sido refutada. Si miramos la vida de manera objetiva y sin restricciones por dogmas o teorías sin fundamento, podemos ver que la vida surge continuamente ante nuestros ojos. Se ha comprobado que la vida biológica tal como la conocemos ahora puede surgir dondequiera que haya agua y quizás también en condiciones iguales o similares a las de nuestro planeta tierra.

iii. La falsa interpretación que entiende la absorción de ácidos nucleicos de los "fagos" y "virus gigantes" como una infección dañina queda refutada. Esta falsa interpretación que remonta a 1952 generó la creencia en virus genéticos en el ser humano que, al transmitir sus ácidos nucleicos "peligrosos", producen enfermedades, causando muerte y destrucción. Hasta la fecha, no se ha observado ni se ha aislado ningún virus en ningún ser humano, animal, planta o en sus fluidos. Hasta la fecha, no se ha aislado ni un solo ácido nucleico que corresponda a la longitud y composición de las cadenas genéticas de los presuntos virus patógenos. Esto pasa a pesar de que se dispone desde hace mucho tiempo de las técnicas estándar más básicas  para el aislamiento, presentación y análisis de la composición de ácidos nucleicos de esta longitud. 

Un premio Nobel y sus desastrosas consecuencias

En forma aislada, los "fagos" y los "virus gigantes" (biontes) pueden fotografiarse rápida y fácilmente en grandes cantidades utilizando el microscopio electrónico. Esto por sí solo atestigua su grado de pureza. El aislamiento y la fotografía de estructuras aisladas y caracterizadas no tuvieron éxito en ninguno de los virus sospechosos de causar enfermedades. Los biontes (también conocidos como fagos y virus gigantes) se ven regularmente en grandes cantidades bajo el microscopio electrónico y se fotografían en los organismos que los producen. Por el contrario, no existe ninguna documentación satisfactoria de los denominados virus patógenos de ningún ser humano, animal, planta o fluido utilizando el microscopio electrónico. ¿Por qué sucede esto?

Las imágenes de microscopio electrónico de supuestos virus solo muestran estructuras que siempre se obtienen de fuentes completamente diferentes. Estas estructuras (como se puede rastrear y verificar fácilmente en base a las publicaciones) nunca se aislaron, ni se caracterizaron bioquímicamente, ni se utilizaron como fuente de fragmentos cortos de ácidos nucleicos a partir de los cuales los virólogos construyen largos ácidos nucleicos que se suponen ser las hebras genéticas de un virus.  

De todos los tipos de "fagos" y "virus gigantes", se pueden obtener ácidos nucleicos de exactamente la misma longitud y exactamente la misma composición en todo momento. Nunca ha sido posible aislar un ácido nucleico (ADN o ARN) de una estructura o de un líquido, cuya longitud y composición correspondería a lo que los virólogos afirman que es el material genético de un virus patógeno.  

Al observar lo que sucedió entre 1951 y el 10 de diciembre de 1954, podemos ver cómo y por qué la virología perdió completamente su camino y terminó con un enfoque peligroso, poco científico y muy alejado de la realidad. Después de que la virología médica terminara con experimentos de control en 1951, a partir de 1952 la estructura del fago se convirtió en el modelo de cómo se presentaría un "virus". La ideología obstinadamente persistente de los 'virus que causan enfermedades' simplemente continuó en una forma diferente: un ácido nucleico de cierta longitud y composición, rodeado por una cubierta que consta de un cierto número de ciertas proteínas. 

Sin embargo: en ausencia de imágenes de microscopio electrónico de "virus patógenos" en humanos / animales / plantas, y a falta de dichas imágenes en forma aislada, de hecho sin caracterización bioquímica o aislamiento, los virólogos todavía se ven obligados a ensamblar componentes separados de tejido enfermo  "por virus" de forma teórica para presentar estos productos inventados al público como virus realmente existentes.

Los virólogos que sostienen la existencia de virus causantes de enfermedades se refieren a una sola publicación  para justificar sus acciones y hacerlas pasar por ciencia. Se entiende que esto es muy poco científico. El artículo publicado el 1 de junio de 1954 describe explícitamente las observaciones de los autores como especulaciones y que estas especulaciones necesitarían verificación en el futuro. Aquella verificación nunca se efectuó, porque el autor principal del estudio, John Franklin Enders, recibió el Premio Nobel por otra especulación dentro de la vieja teoría de que "los virus son peligrosas toxinas proteicas" (una idea ¡refutada en 1951!), Y este Premio Nobel logró dos cosas: la antigua A la teoría refutada de la toxina-virus se le dio un halo pseudocientífico ya la nueva virología genética se le otorgó el más alto y supuesto honor científico. Esto, a su vez, aseguró que la verificación de la publicación sobre el sarampión antes mencionada nunca se llevaría a cabo ". Y este Premio Nobel logró dos cosas: que se le diera un halo pseudocientífico a la antigua teoría refutada de la toxina-virus ; y que la nueva virología genética quedara con el mayor "honor" científico. Esto, a su vez, aseguró que la verificación de la publicación sobre el sarampión antes mencionada nunca se llevaría a cabo.

La nueva virología genética de 1952 en adelante tiene dos fundamentos erróneos: los virus que causan enfermedades están en principio estructurados como fagos y surgen cuando las células mueren en el tubo de ensayo después de que se agregue material de muestra supuestamente infectado. Con su única publicación fechada el 1 de junio de 1954, enders y sus colegas establecieron la idea de que las células que mueren en el tubo de ensayo después de agregar material supuestamente infectado se convertirían en virus. Esta muerte se hace pasar por el aislamiento del virus, ya que se supone que lo que sea que haya creado los cambios DEBE provenir del exterior. Al mismo tiempo, esta masa celular moribunda se utiliza como vacuna. 

Deslumbrados por el Premio Nobel, Enders, sus colegas y todos los demás han pasado por alto el hecho de que la muerte de las células en el laboratorio no es inducida por un virus. Más bien, las células en el laboratorio son destruidas sistemática e involuntariamente sin que nadie se dé cuenta de que esto ¡Eso es lo que están haciendo! Las células se matan con antibióticos tóxicos, por inanición extrema al retirar la solución nutritiva y mediante la adición de proteínas en descomposición que liberan productos metabólicos tóxicos. 

Se juntan de forma abstracta los componentes de esas células que mueren en el laboratorio para formar un virus que se presenta como algo real. He aquí la virología de los virus patógenos. Es así de simple. Hasta el día de hoy, Enders y los “virólogos” nunca han realizado las pruebas de control para “infectar las células del laboratorio con material estéril”. Las células de control mueren exactamente de la misma manera que con el material supuestamente “viral”.   

Una refutación breve, clara y fácilmente comprensible de todos los virus patógenos.

El error y el autoengaño son humanos, comprensibles y perdonables. Lo que no es perdonable son las constantes afirmaciones de los virólogos de que lo que dicen y hacen es científico. Esto es claramente falso, fácilmente demostrable y comprensible para todos. Es por eso que los virólogos que afirman que los virus corona u otros virus causan enfermedades deben ser tildados de estafadores laborales y procesados ​​por medios constitucionales para que se retracten de sus falsas y peligrosas declaraciones. Por lo tanto, la crisis de Corona y otras catástrofes "virales" con consecuencias mortales como el "sida", el "ébola" y otras pandemias "virales" sin fundamento, no solamente se detendrán en el futuro, sino que también se convertirán en una oportunidad para todos. 

La definición de lo que se puede llamar una declaración científica y las obligaciones consiguientes están claramente definidas. En resumen: 

A. Toda afirmación científica debe ser verificable, comprensible y refutable. 

B. Un enunciado puede describirse como científico sólo cuando fracasa su refutación mediante las leyes del pensamiento y de la lógica y, de ser necesarios, mediante experimentos de control. 

 C. Todo científico está obligado a cuestionar y comprobar sus propias afirmaciones. 

 Dado que los virólogos nunca han verificado sus declaraciones por sí mismos y son reacios a hacerlo por razones comprensibles (¿quién querría refutarse a sí mismo, a sus acciones y su reputación?) - lo haremos nosotros con siete argumentos. Cada argumento individual será suficiente por sí solo para refutar la existencia de todos los virus patógenos y para refutar el trabajo de los virólogos (excluidos los que se ocupan de los fagos existentes y los virus gigantes) En los siguientes puntos, se utiliza la palabra "virus" en lugar de la frase "virus patógeno". 

1. La cuestión de la alineación

Los virólogos nunca han aislado el genoma completo de un virus para mostrarlo directamente en toda su extensión. Siempre usan fragmentos muy cortos de ácidos nucleicos, determinan su sucesión de cuatro moléculas y luego se la denominan secuencia. A partir de una multitud de millones de secuencias tan específicas y muy cortas, los virólogos ensamblan mentalmente una larga hebra ficticia de material genético con la ayuda de complejos métodos estadísticos y computacionales. A este proceso lo llaman alignment, que significa alineación.

El resultado de la alineación compleja, la muy larga hebra ficticia de material genético, es declarada por los virólogos como prueba de la existencia de un virus. Sin embargo, tal hebra completa nunca aparece en la realidad o en la literatura científica, a pesar de que las técnicas estándar han estado disponibles durante mucho tiempo para determinar la longitud y composición de cualquier ácido nucleico. Al utilizar el proceso de alineación en lugar de presentar directamente un ácido nucleico correspondientemente largo, los virólogos han refutado su propio trabajo.

2. La falta de experimentos de control con respecto a la alineación.

Los virólogos nunca han realizado y documentado una alineación / orientación con ácidos nucleicos igualmente cortos de pruebas de control. Para ello, DEBEN aislar los ácidos nucleicos cortos del mismo procedimiento de cultivo celular, con la diferencia de que la llamada "infección" no se produce al agregar muestras supuestamente "infectadas", sino con materiales estériles o muestras esterilizadas que hayan sido "infectado por control".  

Estas pruebas de control, lógicas y obligatorias, nunca se han realizado ni se han documentado. Solo con esto, los virólogos han demostrado que sus declaraciones no tienen valor científico y NO deben hacerse pasar por declaraciones científicas. 

 3. La alineación se lleva a cabo solo por medio de construcciones conceptuales 

Para poder juntar las secuencias muy cortas de los ácidos nucleicos utilizados para formar un genoma largo, los virólogos necesitan una plantilla para alinear las secuencias cortas en una cadena genética supuestamente viral muy larga. Sin una plantilla de secuencia tan larga y predefinida, ningún virólogo es capaz de crear teórica / computacionalmente una hebra del genoma viral. Los virólogos argumentan que la hebra genética construida conceptual / computacionalmente proviene de un virus porque la alineación se llevó a cabo utilizando una hebra genética viral predeterminada diferente.

Los virólogos sostienen que la hebra del genoma construida teórica / computacionalmente se origina a partir de un virus porque la alineación se llevó a cabo por medio de otra hebra del genoma viral predefinido. Esta lógica se refuta clara e inequívocamente ya que todas las plantillas fueron generadas exclusivamente por cálculo teórico y no se originaron a partir de un virus.

4. Nunca se han observado virus en un ser humano / animal / planta, ni en fluidos procedentes de ellos.

Los virólogos afirman que los virus infecciosos, es decir, intactos, se encuentran en grandes cantidades en la sangre y la saliva. Por eso, por ejemplo, en la crisis de Corona, todo el mundo debería llevar una máscara. Sin embargo, hasta la fecha, no se ha fotografiado ni un solo virus en saliva, sangre o en otros lugares en humanos / animales / plantas o líquidos, aunque las grabaciones con microscopio electrónico son ahora una técnica estándar fácil y rutinaria. 

Este hecho inequívoco y fácilmente verificable de que no hay registros de virus en humanos / animales / plantas o líquidos de ellos refuta todas sus afirmaciones. Algo que nunca se ha visto en seres humanos / animales / plantas ni en los fluidos de ellos no debe hacerse pasar como un hecho científicamente probado.   

5. La composición de las estructuras que los virólogos hacen pasar por virus nunca se ha definido bioquímicamente. 

Hay dos técnicas diferentes que utilizan los virólogos para tomar fotografías de presuntos virus. Para la microscopía electrónica de transmisión, utilizan cultivos celulares, que incrustan en resina sintética, raspan en capas delgadas y miran a través. Las partículas que muestra en tales imágenes nunca se aislaron y su composición se determinó bioquímicamente. Habría que encontrar todas las proteínas y la cadena genética larga asignada al virus. Ni eso ni el aislamiento de tales partículas incrustadas y la caracterización bioquímica de su composición aparecen en una sola publicación de virólogos. Esto refuta la afirmación de los virólogos de que tales grabaciones serían virus. 

El otro método que utilizan los virólogos para fotografiar virus bajo el microscopio electrónico es la microscopía electrónica reflectante simple y rápida, que se conoce como "tinción negativa". Con el fin de concentrar las estructuras realmente existentes, como los "fagos" y los "virus gigantes", de todos los demás componentes, lo que luego se denomina "aislamiento", se utiliza una técnica estándar para ello, la centrifugación en gradiente de densidad. La presencia, apariencia y pureza de estas estructuras aisladas se hacen visibles en el microscopio electrónico al recubrir estas partículas con una sustancia que contiene metal y las estructuras debajo aparecen como sombras en el haz de electrones. La otra parte de las partículas aisladas, que se hicieron visibles mediante “tinción negativa”, se caracteriza bioquímicamente. En el caso de todos los fagos y virus gigantes, siempre se encuentran los ácidos nucleicos intactos, siempre iguales, siempre muy largos e idénticamente compuestos y se documenta el resultado de la caracterización bioquímica.

En el caso de todos los virus que se definen como virus mediante esta técnica de "tinción negativa", se produce lo siguiente. Estas partículas no se enriquecen, limpian y aíslan con la centrifugación en gradiente de densidad prevista para ello, sino que se sedimentan en el fondo del tubo de centrifugado mediante una centrifugación simple, lo que se denomina "granulación", y luego se observan con el microscopio electrónico. Hasta ahora nunca se ha determinado bioquímicamente la composición de tales estructuras presentadas como virus. Con esta afirmación, fácilmente verificable y comprensible, basada en todas las publicaciones de los virólogos, en las que las estructuras en la microscopía electrónica de transmisión se presentan como virus, sin darse cuenta, los virólogos han refutado también simple y elegantemente, ellos mismos, este argumento de la afirmación de la existencia viral.

6. Las imágenes del microscopio electrónico, que se difunden como virus, son conocidos artefactos típicos o estructuras celulares 

Los virólogos publican multitud de imágenes de estructuras, obtenidas con el microscopio electrónico que, según ellos, son virus. Al hacerlo, ocultan el hecho de que TODAS estas imágenes son soloestructuras típicas de cultivos celulares moribundos, o que representan vesículas de grasa-proteína producidas en el laboratorio y que NUNCA han sido fotografiadas en seres humanos/animales/plantas ni en fluidos procedentes de ellos. Los investigadores que no son virólogos se refieren a las mismas estructuras que los virólogos afirman que son virus como componentes celulares típicos, como las vellosidades (protuberancias parecidas a las amebas con las que las células se aferran al sustrato y sedesplazan), como exosomas o como "partículas similares a los virus". Se trata de otra prueba independiente de que las afirmaciones de los virólogos de ver los virus bajo el microscopio electrónico han sido científicamente refutadas.

7. Los experimentos con animales de los virólogos refutan las afirmaciones sobre la existencia de virus

Los virólogos llevan a cabo experimentos con animales para demostrar que las sustancias con las que trabajan son virus, y pueden causar enfermedades. De cada una de las publicaciones en las que se han llevado a cabo estos experimentos con animales, se desprende que la forma en que se trata a los animales produce exactamente los síntomas que se afirma que son el efecto del virus. Se puede ver en cada una de estas publicaciones que no realizaron experimentos de control en los que los animales fueran tratados de la misma manera con material inicial esterilizado. Estos dos hechos evidentes refutan a los virólogos que afirman haber establecido la presencia y el efecto de los virus en los experimentos con animales.

 

Observaciones finales

Para acabar con la crisis del coronavirus y convertirla en una oportunidad para todos, hay que hacer públicas y efectivas estas refutaciones de la virología que son claras, fácilmente comprensibles y verificables. Una forma de hacer efectivas estas refutaciones es utilizar contra los virólogos los recursos legales adecuados en los tribunales, y hacer públicos los resultados. A través de nuestra lista de distribución de Wissenschaft-Plus les informaremos si tenemos que comunicar resultados que estén listos para ser dictaminados.   

Garantizo con mi nombre que cualquiera que quiera comprobar estas afirmaciones sobre cualquier "virus patógeno" llegará exactamente a las mismas conclusiones, si domina el inglés y ha leído los métodos. Como nota de precaución: mientras continúe la crisis del coronavirus, mis colegas y yo solo responderemos a las preguntas relacionadas con los supuestos virus de coronavirus y del sarampión. Para las consultas sobre todos los demás "virus" durante el periodo de coronavirus, me remito a los artículos publicados en la revista WissenschafftPlus desde 2003.

¡Por favor, hay que tener presente que la sentencia en el juicio del virus del sarampión, confirmada por el tribunal supremo, ha eliminado el fundamento de todo el campo de la virología!  Se ha establecido judicialmente, y por lo tanto forma parte de la jurisprudencia alemana, que la publicación el 1 de junio de 1954 del método fundamental de la virología, en el que la muerte en laboratorio, involuntaria e inadvertida, de las células, se utilizó como ‘prueba’ de la existencia de virus patógenos, ¡y que a partir del año 2016 ya no demuestra la existencia de un virus! La crisis del coronavirus ha aumentado la posibilidad de que el veredicto del juicio sobre el virus del sarampión pueda provocar, por sí solo, un cambio de rumbo en el pensamiento y la actuación de “bueno-malo” que en la actualidad domina la biología, la medicina, la sociedad y el Estado. Tal vez la aplicación al SARS-CoV-2 de uno, varios, o todos los siete argumentos enumerados anteriormente baste para acabar con él, a mi juicio, previsible impulso de la histeria mundial por el coronavirus, y  a la especulación  de los procedimientos de prueba y las vacunas. En relación con el caso del virus del sarampión y en general, me remito a la página de Internet Corona_Fakten en el portal de Telegram. Hay un muy buen resumen de los procedimientos sobre el significado del caso del virus del sarampión, y también otros artículos que son muy buenos. 

Mi optimismo de que la crisis del coronavirus sea una oportunidad para todos se basa en el artículo 1 de la Ley de Protección de la Infección, abreviada Ley de Protección de la Infección. La frase (2) del artículo 1 dela Ley de Protección de la Infección, "Objetivo de la Ley", dice: "La cooperación y la colaboración de las autoridades federales, estatales y locales, los médicos, los veterinarios, los hospitales, las instituciones científicas y otras partes implicadas que sean necesarias para este fin se organizarán y apoyarán de acuerdo con el respectivo estado de la ciencia y la tecnología médica y epidemiológica. Debe aclararse y promoverse la responsabilidad personal de los patrocinadores y gestores de las instalaciones comunitarias, las empresas alimentarias, los centros sanitarios y los particulares en la prevención de las enfermedades transmisibles".

Todas las medidas y ordenanzas contra el coronavirus, y así como las leyes establecidas debido al coronavirus, se basan única y exclusivamente en la Ley de Protección de la Infección. Sin embargo, puesto que la "estipulación de objetivo” en el artículo 1 de la Ley de Protección de la Infección "se diseñará y apoyará de acuerdo con el estado actual de la ciencia y la tecnología médica y epidemiológica", ha sido refutada por las declaraciones publicadas de los propios virólogos, y se ha demostrado que es anti-científica, todas las medidas, ordenanzas y leyes a causa del coronavirus carecen de base legal para ser aplicadas. Ninguna de las instituciones y gestores de instalaciones comunitarias, establecimientos alimentarios, centros sanitarios a los que se refiere el artículo 1, párrafo (2), así como el individuo, es decir, cada ciudadano al que se dirigen las leyes y a quien afecta, pueden llevar a cabo ni tolerar las medidas yregulaciones del coronavirus si han reconocido y aceptado en el artículo 1, apartado 2, que los virólogos no tienen pruebas científicas de la existencia de virus causantes de enfermedades, sino que se han refutado así mismos a través de sus propias acciones y publicaciones.Mientras se mantenga la obligación de la investigación científica del artículo 1 de la Ley de Protección de la Infección, es posible, con referencia al artículo 1 de esa Ley de Protección de la Infección, presentar conéxito ante los tribunales las pruebas de la falta de fundamento, anarquía, nocividad e inmoralidad de todaslas medidas, decretos y leyes del coronavirus. La mayoría de jueces son honestos y conscientes, siguen la ley, porque de lo contrario en este país habría gobernado durante mucho tiempo una dictadura abierta, que quiere construirse cada vez más visiblemente, mediante argumentos pseudocientíficos y refutados de la virología y la medicina. 

Por favor, al hacerlo tengan en cuenta lo siguiente:

La mayoría de la población cree en la existencia y el efecto de los virus patógenos, y en el efecto positivo de las vacunas. Para decirlo de forma drástica: los que creen en el cáncer como efecto de un principio de maldad malentendido, también creen en las metástasis, y creen en las "metástasis voladoras", también conocidas como ‘virus’. El sufrimiento experimentado de forme directa e indirecta por casi todos los seres humanos, con las consecuencias negativas de los diagnósticos de cáncer y sus graves tratamientos, cala hondo y tiene efecto. Por favor, tengan en cuenta que este sufrimiento, experimentado directa e indirectamente, ha creado y ha reforzado el sentimiento y la certeza en la gente de que existen enfermedades y virus peligrosos y mortales. Obsérven que de éstas y otras experiencias puede resultar la opinión de que ‘solo nuestro Estado y sus especialistas son capaces de tratar con él’, y se les permite hacerlo. Así evitarás que tus acciones tengan el efecto contrario. Esto es especialmente importante cuando se trata de médicos, a los que todos necesitamos.

Por ejemplo, yo le explico a cada persona que se lo cuestiona que existe un sistema de conocimiento mejor que explica científicamente (en sentido positivo) los procesos que conducen a la enfermedad y a la curación, que se pueden producir crisis de curación, y que los obstáculos a la curación pueden ejercer su efecto. Sin embargo, para poder aceptar este nuevo punto de vista, a menudo el requisito previo es que se reconozca como desmentido el sistema anterior cuyas explicaciones se basan en la teoría celular. La crisis del coronavirus es una oportunidad única, y un claro llamamiento a defender la vida y los tres ideales universales de la humanidad: libertad, igualdad y fraternidad, es decir, la estructura social triple de las comunidades humanas. (Véase el artículo de este número de WissenschafftPlus del 4/2020, "Die sozialeDreigliederung" - El tripartito social).

                                                           ***

Esta contribución se imprimirá en nuestro libro "Corona – Weiter ins Chaos  oder  Chance  für  Alle?" Veanse la reseña del libro en la página 46 en esta edición de w +.

                                                            ***
 

Traducción: David Montoute 

Original en alemán: https://wissenschafftplus.de/uploads/article/wissenschafftplus-virologen.pdf

English summary:  https://threadreaderapp.com/thread/1372238605901557761?refresh=1617978778  

The scam is confirmed: PCR does not detect SARS-CoV-2, but endogenous gene sequences

 

 

 

Jesus Garcia Blanca

via Corona Investigative, February 08, 2021

 

The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed "genome" and even the so-called "target genes" allegedly specific to the "new coronavirus". The test is worthless and all "positive" results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world's leading experts on PCR, in fact says that under certain conditions anyone can test positive! 

We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report "Can you prove that there are pathogenic viruses?" on our website -www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes.

We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive. In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the "human coronaviruses". And the conclusions are extremely serious: none of the seven "human coronaviruses" have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.

We are going to explain step by step the research that has led us to such an unusual conclusion.

HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED?

During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on "isolates" of previous "human coronaviruses", we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results:

Coronavirus 229E

Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966.

Since the authors refer to other articles to explain the method of isolation - which they call Complement Fixation - we consulted a reference article for that method: that of Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected.

Coronavirus OC43

Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.

What was considered to be viral RNA was extracted from cultures without any proof that the RNA belongs to a virus. The tool used - a QIAamp kit - removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. And there are no controls. It is then amplified by PCR and sequenced assuming (!) that it is genetic information of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a "virus" is being worked with.

SARS-CoV Coronavirus

Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that "the viruses were isolated in fetal monkey liver cells from nasopharyngeal aspirates and lung biopsies of two patients". There are no controls. The only mention is of a "cytopathic effect" that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with "random initiators" and a sequence "of unknown origin" is detected to which "a weak homology with the coronaviridiae family" is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive.

Coronavirus NL63

Reference article: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

The authors state that "the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed". What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let's see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of "cytopathic effect". The novelty introduced by this method is that "restriction enzymes" are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are "virus-like particles", "retrovirus-like particles", "endogenous retroviruses", "exosomes", "extracellular" particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as "viruses" and therefore can falsify results by producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that "no redundancy is expected in the VIDISCA insert from the host background nucleic acid except in the case of 'virus-like' characteristics, i.e., high copy numbers as in mitochondrial DNA."

Coronavirus HKU1

Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.

The article, incredibly, begins with these words: "Despite extensive research in patients with respiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures." And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out "predictions" on how nucleotides should be combined. The text adds: "The sequences were manually assembled and edited to produce a final sequence of the viral genome". And once again there are no controls.

MERS-CoV Coronavirus

Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.

The genetic material is extracted directly from the culture supernatant and sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls. In short, what had been done with the first coronaviruses -and with many other supposed viruses- is to cultivate supposedly infected tissues - any "cytopathic effect” was attributed to the presence of a virus only - and then either some proteins are obtained which without any test are considered "virus antigens" and when these "antigens" are detected in cultures it is interpreted as "isolation", or fragments of nucleic acids are extracted assuming that they belong to a virus.

We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called "cytopathic effect" is actually an effect caused by the conditions (poisoning & starvation) of the culture itself. This is recognised for example in the article Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf) It explains that certain substances -such as antibiotics- added to in vitro experiments can stress the cell cultures so that they generate new sequences that had not been previously detected. This had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.pdf

In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.

And the obvious consequence of the lack of evidence of its isolation is that such "coronaviruses" cannot be held responsible for any disease. Moreover, all tests - of whatever kind - based on the presumed components of these "viruses" (nucleic acids or proteins) are completely disqualified as "infection tests" and even more as "diagnostics" of diseases.

MORE UNANSWERED REQUESTS

In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not "purified" which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities - political and health - from various countries about the purification and isolation of SARS-CoV-2.

James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm- tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that "it has no records that could provide an answer to their request". The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: "The position of the university is that material of academic debate cannot be subject to the Freedom of Information Act". It follows from the NVR's request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having "detected SARS-CoV-2 RNA in diagnostic samples.”

On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn - professor at Imperial College London -, the engineer and independent researcher - who we interviewed in the journal at the time - David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger Watson and the biologist and chemist David Rasnick - and to this day they still have not received a reply!

Another similar request - in this case to the National Research Council of Canada - received the following response: "We have not been able to carry out a complete search of the NRC's records so we regret to inform you that no records have been identified that respond to your request.” We will add that two journalists have been sending similar requests - under the Freedom of Information Act - to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/

LOOKING FOR THE ORIGIN OF THE FALSE GENOME

The question we asked ourselves then was: if the sequences that have been published do not belong - as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.

First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:

• China CDC protocol: uses ORF1ab and N genes as target.
• Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).
• United States CDC protocol: uses three fragments of the N gene.
• Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
• Charite Protocol (Germany): uses the E, N and RdRP genes. - Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
• National Institute of Health Thailand protocol: uses the N gene.

We then introduced the sequence of the primers - the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) - into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.

THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!

Let's see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.

We then returned to the homepage and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.

And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!

We then decided to repeat the operation but with the final or reverse primer - which is CTCCCTTTGTGTGTGT - and the results were similar.

Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the "SARS-CoV-2 genome" and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: Once there, we located the "target sequence", a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the "genome", which is this one:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed "target sequence" of SARS-CoV-2 both in microbes and in our own genome.

Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA.

We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.

We finally decided to test with the S gene which is said to generate the structural "spike" proteins that are key to entry into the cell and was subsequently considered to be the most specific SARSCoV-2 gene. Since it is a gene whose sequence is much longer - 3821 nucleotides between positions 21,563 and 25,384 - we tested with two fragments chosen at random within that gene and the first - TTGGCAAAATTCAAGACTCACTTTC - resulted in another hundred microbe sequences and 93 sequences of the human genome and the second - CTTGCTGCTACTAAATGCAGAGTGT - a hundred microbial sequences and 90 of the human genome.

Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!

CONCLUSIONS

The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that ALL THE NUMBERS OF "CASES", "INFECTED", “SICK", "Asymptomatic" OR "DEAD DUE TO COVID-19" LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.

We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic tests for SARS-CoV-2 - it is available at https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve - and it literally says on page 5: "Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target". That is, WHO agrees to use non-specific sequences to detect SARS-CoV-2.

That is not all because the manual later states, "An optimal diagnosis consists of a NAAT test with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used.”

The WHO manual states, "One or more negative results do not necessarily rule out SARSCoV-2 infection. There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR.” What are the judges waiting for to act on their own initiative?

What are the judges waiting for to act on their own initiative?

 

Original version:  https://www.dsalud.com/reportaje/la-estafa-se-constata-la-pcr-no-detecta-el-sars-cov-2/

 

The Virome and the Vitality of the Genome

NOTE: We at FW, do not share Thomas' assumption of a viral zoonosis as the causative event for the hypothetical Sars CoV-2. But as a general expostion of the place of viruses in the global ecology and human terrain, this interview is indispensable.

Luogo Comune, February 23, 2021

Dr. Thomas Hardtmuth was a surgeon at Heidenheim hospital for many years. Since 2015, he has devoted himself entirely to the study of microorganisms. Talking to him opens up a new perspective on viruses, frequently reviled as mere pathogens.

How does a surgeon get to deal so intensely with microorganisms and especially with viruses?

THOMAS HARDTMUTH: The initial spark was the Deepwater Horizon disaster in 2010. The oil rig of the same name in the Gulf of Mexico burned and sank. Crude oil spilled into the sea for three months, totalling 800 million litres. In the course of the reports, I had read that the oil was broken down by bacteria called Alcanivorax borkumensis. They were discovered near Borkum, hence the name. They scarcely occur in clean seawater, but as crude oil spreads there, they suddenly make up 90% of the water's bacterial population, after which they disappear again. Microorganisms could be defined as a kind of immune system of the oceans or the biosphere. Their job is to bring everything back to natural cycles. This is what Alcanivorax did in the Gulf of Mexico. People don't think about how these material cycles work so wonderfully. Almost nothing was read about this in the case of that oil catastrophe, only horror stories. For me, this was a reason to take a closer look at microorganisms as beneficial beings in the world. The composition of germs in the oceans, rivers, lakes and soil - it's like an orchestra playing together in a masterly way.

What did you find out about viruses?

TH: Viruses are involved in the regulation of population dynamics. Wherever there is a surplus, too much mass, viruses come to balance, regulate and correct; create a balance in the biosphere. This also applies to us humans. Evolutionary biologist Wolfgang Schad once said that viruses are the original substance of physical life. Modern science sees it similarly. The "virus first" hypothesis or the concept of the "RNA world" simply means that the first things that existed in the living world were viruses. But without stable structures, it was all a single fluid, without direction, just "creative chaos". There is much scientific evidence today for the fact that the basic elements of life, such as nucleic bases and amino acids, from which viruses are also made, came to earth from the cosmos. Having no metabolism of their own, viruses are completely dependent on the environmental context. But viruses carry genetic information into the cell, what is done with this information is not decided by the virus, but by the cell or organism. The central mistake that prevails today is that viruses are seen as acting agents, as subjects acting autonomously. This is also the elementary error of thought in the Corona crisis. It is not the viruses themselves that change something, but the organism that changes something with the help of viruses as a basic physical substance.

Could you clarify this a little?

TH: The spiritual roots of this problem go back to the mid-19th century, when the whole theory of infection was born. This concerned the great historical dispute between Robert Koch (1843-1910) and Louis Pasteur (1822-1895) on the one hand, and Max von Pettenkofer (1818-1901) and some French researchers such as Claude Bernard (1813- 1878) on the other. Koch and Pasteur were of the opinion that any infectious disease was caused solely by bacteria or viruses, while Pettenkofer and his fellow researchers believed that the decisive factor was the environment that pathogens encounter, the living conditions and external circumstances. To prove that germs alone do not cause disease, Pettenkofer and some of his students drank half a litre of water contaminated with cholera bacteria. None of them got cholera. Some had some diarrhea and that was it. But all this did nothing. Koch and Pasteur emerged as victors from this dispute, even if both worked with unfair methods. However, since then the dominant opinion has been that everything bad comes from microorganisms, and if these were destroyed, there would be no more disease.

How did they cheat?

TH: Koch didn't exactly cover himself in glory with his tuberculin scandal. Pasteur left about 100 notebooks on his experiments and decreed that those notes were never to be published. But a great-grandson of his made them available, and the American medical historian Gerald Geison (1943-2001) analysed them and published them in his book "The Private Science of Louis Pasteur". It shows a notable contradiction between what has been written about his experiments in his notebooks and what he had published. Anything that didn't fit, he simply omitted. But to this day, his reputation has not suffered. Science deliberately ignores this.

But bacteria and viruses can be contagious...

TH: Yes, of course, but they are not the only factor that determines whether you get sick or not. This is illustrated by an example from the time of the Spanish flu. This flu epidemic did not start in Spain, but rather in about 20 military camps in the United States. The Spaniards were only the first to make this fact public. These camps were the 'hotspots', hopelessly overcrowded with soldiers, and in these extremely cramped conditions and under the stress of the First World War, this epidemic then broke out, and in fact, in all camps almost simultaneously. It was not possible to trace any chain of infection between the individual camps. Therefore, some rather brutal attempts were made to induce infection: prisoners from military prisons were recruited as guinea pigs and were promised pardons if they became available for these experiments. They then brushed secretions from seriously ill people with the flu and sprayed them into the mouth and nose of the test subjects. This is a method that no ethics committee would approve of today. In the first batch of experiments in Boston, none of the 60 subjects became infected, not even one! Then the experiments were repeated in San Francisco, but there was no contagion there either. All this can be read in the book "Influenza" by Gina Kolata, an American molecular biologist and science journalist. It can be seen from this that viruses are not the main actors, but the organism itself, which in a healthy condition prevents viruses from entering its cells. This does not depend on the virus, but above all on the state of the organism! But even if a virus is welcomed into a cell, there are still many different ways the body copes with it. The radical fixation on microbes as the cause of all evil is creating all this chaos that we have today. This is where fear arises because human beings seem to have no power to influence what is happening and are powerless in the face of the viral threat. And fear is worse than the virus, because it weakens the immune system.

Why is the other aspect, the environment, so ignored?

TH: All standardised medicine and large-scale drug industry is based on Koch and Pasteur. We stopped looking at the individual person and his living conditions, in order to stare down the microscope. We were completely fixated on the elimination of pathogens and no importance was given to the human being and his condition. We decared that everything could be done in the laboratory. This was a paradigm shift in medicine that is still in effect today. From the times of Hippocrates (c. 460-730 BC) and Galen (c. 129-199 AD), lifestyle was considered the basis of all health. But this has largely been eliminated from medical thinking and the focus has been solely on fighting germs. Without this enemy image of viruses, a corona crisis and global panic would not even be possible. These fear patterns have become deeply rooted in thinking habits, and are being nurtured again and again by the media. Furthermore, the definition of the term pandemic was changed in 2009 in the context of swine flu. Previously, a pandemic was defined by three criteria: 1) it had to be a new virus, which 2) it had to spread rapidly, and 3) it had to cause severe disease symptoms and many deaths. They simply deleted point 3 at that time. This has made it possible to declare every wave of flu, such as the recent swine flu, as a pandemic. That one was the most harmless wave of many years, but it brought gigantic revenues to the pharmaceutical industry. If you look closely, the cause of pandemics is always found in living conditions. It's never just bacteria or viruses, it's always the environment too. 

Do you also mean the ecological side?

TH: Yes, this is expressed today in the "One Health" movement: Health is no longer conceivable without ecology. Take schistosomiasis, for example, which kills hundreds of thousands of people every year, mostly in Asia and Africa. Schistosomiasis is a worm disease transmitted by water snails. The worm larvae pierce the person's skin and migrate to the internal organs where they develop into pairs of adult worms whose eggs are expelled through the bladder or intestine and in turn reach the water and snails as intermediate hosts. In the past, schistosomiasis was less of a problem because snails were eaten by crayfish. However, since more dams have been built in Asia and also, for example, in Egypt in Aswan, crayfish no longer find adequate living conditions, snails multiply en masse and with them the pathogens of schistosomiasis. The situation is similar in the case of malaria. A study in Brazil showed that the number of malaria cases increases by 50% if only 4% of a region's rainforest is cleared. If you want to study epidemics, you have to search: Where do inhuman conditions reign? Where is nature not in balance? Where there is fear, terror, hunger and malnutrition and, above all, cramped and inadequate living conditions for humans and animals? Where are the spheres of autonomy of living beings disturbed? That's where epidemics break out. Wars are the best subject of study for epidemics. In purely biological terms, an epidemic is a microbial monoculture. Monocultures are always linked to pathologies - in agriculture and forestry as in industrial farming, but also in the social sphere, then we speak of conformity or totalitarianism.

Where did this happen in the Corona case?

TH: Changes in ecology are always accompanied by viral infections. And humans have massively changed the ecology and knocked it out of balance in many places, with industrial agriculture and industrialization and many other measures. When living conditions change, the genome of organisms must also adapt accordingly, and viruses have always been a kind of material in this sense. Because rewriting genomes is complicated. If you look at the flu virus family tree, they go back to ducks in China. In the 17th century, they started putting ducks in rice fields. They ate snails and weeds and fertilized the fields with their excrement. This was a wonderful ecological-economic symbiosis between the rice culture and the ducks. In the 1980s, the Chinese began building American-style poultry farms, especially in Guangdong in the south. Today, numerous pathogenic viruses originate there, which are mutants of the original paddy ducks, but in which they did not produce any disease. Farms are real hotspots for pathological germs. Personally, I don't think we're really dealing with a completely new virus in the case of Corona, but with a mutation that comes from one of these meat factories. The interesting question is: why a virus in an animal that through humans undergoes stress turns into a pathogenic form for humans?

It almost seems like nature's revenge...

TH: This is where the biology of morality begins! Whenever we intervene martially in natural conditions and act insensitively and destructively, debris is created, and these fly around our ears like epidemics. Viruses and bacteria, which have reached these conditions of total equilibrium over millions of years, suddenly become homeless and turn into refugees. And then they enter situations to which they don't really belong. This is precisely the most typical phenomenon, that only a virus' change of host is connected to the disease. This is why microbiome research is so exciting. There are about 50 trillion microorganisms that colonise us, mainly in the intestine, and their composition is highly individual for each person. The bacteria-to-virus ratio is about 1:10, so we harbor far more viruses than bacteria. Among them there are also many so-called pathogens, which however are in a balanced quantity ratio with each other - they only become pathogens in the form of monoculture, when a species takes over. Today it is assumed that the ecological balance of our individual intestinal flora is regulated through viruses. And an individually balanced gut microbiome has a lot to do with our soul-spiritual health. Rudolf Steiner once spoke this strange phrase: "We take thoughts from the intestinal flora". It took me a long time to understand that.

Can you explain it?

TH: These microorganisms in us represent a kind of memory of the primordial past. We all emerged from it and have preserved an extract of the primal biosphere in our intestines. Steiner repeatedly speaks of man as a contracted and individualized world being. One could talk at length about it, this ancient philosophical approach of microcosm and macrocosm. If we take this literally and think of all of nature in its germinal state in us as a microbiome, then no further evolution can take place. And the microorganisms must remain in this original state, otherwise they become pathological. If they start to evolve, then we are dealing with infections. And when Steiner thinks we are taking thoughts from them, it is precisely these formative forces that normally condition the further evolution of microbes into higher and multicellular life forms. We take this creative potential from the microorganisms and use it for ourselves in the formation of thoughts. Modern research has long been aware of this gut-brain axis. The vitality of the soul-spiritual element in man strongly depends on the integrity of this microscopic world. Man constantly overcomes the inherent laws of microorganisms so that they do not develop further. Here it is above all a question of forces; and less one of chemistry. When a person becomes depressed or suffers from anxiety disorders, it is a problem with the balance of these forces, not a brain disorder. We have to get out of these biochemical thinking patterns. We can no longer biochemically analyse these millions of different microbial species that interact in us; we go hopelessly against the wall with our conventional methods of study . We have to think differently, no longer in terms of substances, but dynamically, in terms of forces. Here I envision us upon the threshold of a new medicine.

Let's go back to the Coronavirus again. Is SARS-CoV-2 a reality?

TH: Yes, sure. But these Corona viruses are everywhere. If a person gets pneumonia today, they often find it because they are looking for nothing else. If you look closely, you will find hundreds of different viruses and their mutants - highly individual in each person - behaving differently in such an infection. This viral world must be forced into visibility with an enormous technical effort to be able to perceive it; this is only possible in the electron microscope. There you see a still snapshot of something that is actually a highly dynamic process.

And in your opinion, what are these serious developments due to?

TH: Not to viruses, but to conditions. Why should the same virus cause different serious diseases in different countries? That does not make sense. Severe courses affect people who are either very old, are in situations of high load or under permanent stress, or who already have several diseases and a weak immune system. You always have to look closely and analyse the conditions. There are countless different ways to make people immunologically weak. Loneliness, for example, being left alone is one of them. We now know that loneliness is one of the most potent disease factors of all, and many people have died of loneliness in nursing homes and nursing homes after the lockdown - with or without the virus. In Italy, there were many Polish geriatric assistants who rushed home at the start of the lockdown, many elderly people were suddenly left without sufficient assistance and left alone. In addition, hospital beds are very scarce in Italy, Spain and even France in the countryside due to austerity measures, which leads to the decompensation of care facilities and overcrowded wards every year in the context of flu waves. There are always many factors that lead to a change in mortality in various countries; it cannot be explained by the virus alone.

Do you think the SARS-CoV-2 PCR test is useful?

TH: It's very debatable, to say the least. I don't know what is actually being measured. Of course, it can be said that it is the genome of the virus. But you start to think if you know the dynamics of viruses and know how viruses treat their genetic material - there is a constant shredding and shifting back and forth. Viruses are "world champions in splicing", as noted virologist Karin Mölling puts it. Splicing is the genetic plasticity with which gene transcripts adapt to their respective situational environmental context. The PCR test represents extremely narrow tunnel vision. A tiny genetic particle is chosen from the smear among countless microorganisms and it is declared that this is the causal origin of a disease, in this case of Covid-19. I can't understand this. The more you study the PCR test, the more questionable it becomes. If everyone was made aware of the reliability and lack of validity of this test, the pandemic would probably be over quickly. It can truly be defined as gross, even criminal, and misleading when constantly talking about new infections. These are just test results, which in the first place say nothing about a person's health status. But the whole pandemic argument is based on this test. However, we are constantly populated by tens of thousands of viruses. There are always new ones, just as there are always new things in the world that we welcome and process - in this, the biological and spiritual levels are very similar. Some things cause a crisis, others overwork us and we get sick. But most are simply integrated as an experience - without disease. 99% of all viral infections pass without symptoms of disease. We keep reworking our genome with the help of these viruses. More and more we discover that our genome is composed of viruses.

Excuse me?

TH: We know this from retroviruses, whose genes are integrated directly into the genome of the host cell and then - when this happens in the germ cells - it leads to a genetic change in the species with new characteristics. In the human genome, there are thousands of so-called endogenous retroviruses that can be traced to previous "infections". Whenever something new happens in evolution, when organisms genetically change, it is related to viruses. They are the physical substratum of all innovation and biodiversity, in a sense the "original fertilisers". We have recovered the vitality of the genome from the viral world, that is, we owe it to them. All the flexibility and genetic vitality is made possible by viruses. They represent biodiversity on earth. They are highly labile; they constantly decompose and recompose. The so-called virosphere is the earth's dynamic gene pool, from which organisms help each other to make new properties. The time has come to look at viruses with different eyes.

 

 

Source: https://luogocomune.net/21-medicina-salute/5720-dobbiamo-la-vitalit%C3%A0-del-genoma-al-mondo-dei-virus